Dataset for CDS BCL-2-like of organism Dromaius novaehollandiae

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatgggagcggtt
cgtggacctctacgggaataatgctgctgctgagataaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggcaggcgtgcttctgctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=633 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatggcgctgcat
gggactctgcccgtgggaggtatatggcctacagatgtctgagttttcttcttgcttctgctttgggatctga
>gnl|bcl2dbcds|A0A8C4K2K9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=MCL-1 (length=537 residues).
cctgtggggaggcctctggggggggtgtgtgggcctggcctgtgtggggccctcgaggtgggtgggcaccggctctgccc
cgcggctgcaggcagctctgggggctgggggcgacctgggcccccaccagctttgggggctggagcgaggctgcagatcg
cctctcccgcagggatgctgcggaagctggacatccagaaggaggaggacctgcagtccgtgtgcgaggtggcagcccac
gttttcagtgacggagtaacaaactggggcagagttgtgacactcatctcgtttggtgcctttgttgcgaaacacctgaa
gagcataaaccaggagaagtgcatcagctcgttagcagggatcatcacagacgcgctggtctcctctaaacgggagtggc
tagtgagccagggaggctgggagggcttcgtcgacttcttccgcgtggaggacctggaagggagcatcaggaacgtcctg
atggctttcgcgggcgtcgccggactgggcgcgagcttggcctacatgatccggtga
© 1998-2022Legal notice