Dataset for CDS BCL-2-like of organism Myotis lucifugus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1P9D2_BCL2L1-01       ------------------atgtctcagagcaaccgggaactggtggttga
G1P3J2_BCL2L2-01       cctgaaatgctccattctgtgtctctgactaaatatactcatgccagt--
G1Q051_BCL2L2-01       ------atgaatgaattt---tctctagacaactttatgctctatagt--
G1QEX2_BCL2L10-01      --------------------------------------------------
G1PZ39_MCL1-01         --------------------gccccg------------------------
G1QAV8_MCL1-01         -------------atgtttggccccaaaagaaatgcattcatcggactca

G1P9D2_BCL2L1-01       ct------------------------------------------------
G1P3J2_BCL2L2-01       --------------------------------------------------
G1Q051_BCL2L2-01       --------------------------------------------------
G1QEX2_BCL2L10-01      --------------------------------------------------
G1PZ39_MCL1-01         --------------------------------------------------
G1QAV8_MCL1-01         acctccactgcgggggggcagttgggggcctgtggcggcagcgaagccta

G1P9D2_BCL2L1-01       --------------------------------------------------
G1P3J2_BCL2L2-01       --------------------------------------------------
G1Q051_BCL2L2-01       --------------------------------------------------
G1QEX2_BCL2L10-01      --------------------------------------------------
G1PZ39_MCL1-01         --------------------------------------------------
G1QAV8_MCL1-01         catctccttcaggaaggaggtccctgcccccaagagtcaggggcggggag

G1P9D2_BCL2L1-01       --------------------------------------------------
G1P3J2_BCL2L2-01       --------------------------------------------------
G1Q051_BCL2L2-01       --------------------------------------------------
G1QEX2_BCL2L10-01      ---------------gacgagttgaagt----------------------
G1PZ39_MCL1-01         --------------------------------------------------
G1QAV8_MCL1-01         ggaaacgggcacggtgattggctggagcgctggcgcgagcccccaagcca

G1P9D2_BCL2L1-01       --------------------------------ttctctcctacaagcttt
G1P3J2_BCL2L2-01       --------------------------------cttttatcc-ttgacctt
G1Q051_BCL2L2-01       --------------------------------tttgattctgttgatatt
G1QEX2_BCL2L10-01      --------------------------------tgcgcacccgacggctgc
G1PZ39_MCL1-01         --------------------------------ccctctcccattagcggc
G1QAV8_MCL1-01         ctctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggc-ac

G1P9D2_BCL2L1-01       cccagaaaggatacagctggagtcagtttagtgatgtggaagagaacaga
G1P3J2_BCL2L2-01       t--------acagccgcccggatg--------------------------
G1Q051_BCL2L2-01       a--------g-----gcccaaagt--------------------------
G1QEX2_BCL2L10-01      t--------ga-----ccga-gtt--------------------------
G1PZ39_MCL1-01         c--------gagggccccgacgtc--------------------------
G1QAV8_MCL1-01         g--------gagggtcccgatggc--------------------------

G1P9D2_BCL2L1-01       actga---------ggccccaga---------------------------
G1P3J2_BCL2L2-01       gc------------gaccccagcctc-g----------------------
G1Q051_BCL2L2-01       gctgggtcctaagagctcccagcctcag----------------------
G1QEX2_BCL2L10-01      cctgg---------aacaccgcacccgaaggc------------------
G1PZ39_MCL1-01         atcgg---------gacccttcgcgcggcggctgtttgcgccccttggct
G1QAV8_MCL1-01         accgc---------ggcccct-gccaggtggctgttctcgcccatcagc-

G1P9D2_BCL2L1-01       ---agggactgaatcagaggtggagacccccagtgccatcaatggcaacc
G1P3J2_BCL2L2-01       ----------gccccagacacacgg---gctctggtggcagac-------
G1Q051_BCL2L2-01       ----------gccccagacacacag---gctctggtggcagac-------
G1QEX2_BCL2L10-01      --gcggcactgccccgcag-------------cagccgtccacgc-----
G1PZ39_MCL1-01         gtgcggggctgccc-gcggagatggaaagccgcggccgccgacgccatca
G1QAV8_MCL1-01         ---cggaattgccctgaagagctgg-gagctctggcagccgacgccatca
                                 *                       *      *        

G1P9D2_BCL2L1-01       catc----------------------------ctggcacc----------
G1P3J2_BCL2L2-01       -----------------tttgtaggctacaagctgaggca------gaag
G1Q051_BCL2L2-01       -----------------tttgtaggctacaagctgaggca------gaag
G1QEX2_BCL2L10-01      --------------------------------ccgaggcc----------
G1PZ39_MCL1-01         tgtcgccggaagaggagctggacgggtacgagccggagcctctcgggaag
G1QAV8_MCL1-01         tgtcgcccggagaggagctgggcaggtatgagccggagcc------gaag
                                                       * *   *           

G1P9D2_BCL2L1-01       tggtggacagccctgcggtgaatggagccactggccacagcagtagcttg
G1P3J2_BCL2L2-01       g--------gttatg---tttgtggagcgggtc-------ccgga----g
G1Q051_BCL2L2-01       g--------gttatg---tttgtggagcgggtc-------ccgga----g
G1QEX2_BCL2L10-01      ------accgtgatgcgctccctg--gctgct------------------
G1PZ39_MCL1-01         cggccggccgtcctgcccttggtgcagctggtcggggaggccagc----g
G1QAV8_MCL1-01         cagccggctgtcctgcccttgctccagctggtcggggaggccagc----g
                                *   **   *   *   **   *                  

G1P9D2_BCL2L1-01       gatgccc---gggaggtgattcccatggcagcggtgaagcaagcgctgag
G1P3J2_BCL2L2-01       agggccc---agcagctgaccc-----gctgcaccaagccat-----gcg
G1Q051_BCL2L2-01       agggccc---agcagctgaccc-----actgcaccaagccat-----gcg
G1QEX2_BCL2L10-01      ----------cattcgtggctg-----ggtaccccgcactcctggtccc-
G1PZ39_MCL1-01         gcggccccggcgcggggggctc-----gctgccctccacgcc--gccccc
G1QAV8_MCL1-01         aaggccc---cgcaggtggctc-----actgccctcgacccc--gccccc
                                        *             *                  

G1P9D2_BCL2L1-01       ggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcgacc
G1P3J2_BCL2L2-01       ggcagctggagatgagttcgagacccgtttccgtcgcaccttctctgatc
G1Q051_BCL2L2-01       ggcagctggagatgagtttgagacccatttccgatgcaccttctctgatc
G1QEX2_BCL2L10-01      ------ggaggcagag---aaa----------------------ccgact
G1PZ39_MCL1-01         cgcggaggaggaggaggacgag----------------------ctgttc
G1QAV8_MCL1-01         tgctgaggaggaggag---gaa----------------------ttgtca
                              *  *  ***    *                         *   

G1P9D2_BCL2L1-01       tgacatcccagctccacatcaccccagggacagcatatcagagctttgag
G1P3J2_BCL2L2-01       tggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
G1Q051_BCL2L2-01       tggtggctcagctgcatgtgaccccaggttcagcccagcaatgtttcacc
G1QEX2_BCL2L10-01      cga----------gcagatggtcg---------acca----------gat
G1PZ39_MCL1-01         cggcagtc--gctggagatcatct---------ctcggtacc---gggag
G1QAV8_MCL1-01         c------t--gctggagatgatcc---------ctcagcaccttagggaa
                                      *  *   *                           

G1P9D2_BCL2L1-01       caagtagtgaatgaactcttccgggat----------ggggtgaactggg
G1P3J2_BCL2L2-01       caggtctctgatgaactcttccaaggg----------ggccccaactggg
G1Q051_BCL2L2-01       caggtctctgatgaactcttccagggg----------ggccccaactggg
G1QEX2_BCL2L10-01      agagtcgctagtt-------ccagacg-----gcacagaccccaactggt
G1PZ39_MCL1-01         caggcgaccggcg-------ccaaggac----gccaagcccctgggcggg
G1QAV8_MCL1-01         cggg---ctggcg-------ccagggaccaaagccagggccc---gcggg
                          *                **               *         ** 

G1P9D2_BCL2L1-01       gtcgcattgt----------ggcctttttctcgtt---------------
G1P3J2_BCL2L2-01       gtcgccttgt----------ggccttctttgtctt---------------
G1Q051_BCL2L2-01       gttaccttgt----------ggccttctttgtctt---------------
G1QEX2_BCL2L10-01      tgagcgtggt----------ggcgctcgtgtcctt---------cgcgg-
G1PZ39_MCL1-01         cccgcggcctccagccggaaggcgctggagaccctgcggcgggtcgggga
G1QAV8_MCL1-01         tcggcggggtgcagc-----ggcg----------tgcagcagggtgcag-
                           *    *          ***           *               

G1P9D2_BCL2L1-01       cggtggggcattgtgcgtggaaagtgtg------------------gaca
G1P3J2_BCL2L2-01       tggagctgctctgtgtgctgagagtgtc------------------aaca
G1Q051_BCL2L2-01       tggagctgctctgtgtgttgagagtgtc------------------aaca
G1QEX2_BCL2L10-01      --gggccctgctgga----gagaccgccgccaggccactcgcaggcacgc
G1PZ39_MCL1-01         cggcgtgcagcggaaccacgagatggcc---------ttccaaggtgagc
G1QAV8_MCL1-01         cggggtgcggcag------gagactgcc---------ttcctaggtatgc
                         * *       *      ** *  *                        

G1P9D2_BCL2L1-01       aggagatgca----------------------------------------
G1P3J2_BCL2L2-01       aggagatgga----------------------------------------
G1Q051_BCL2L2-01       aggagatgga----------------------------------------
G1QEX2_BCL2L10-01      agggaatggg----------------------------------------
G1PZ39_MCL1-01         gggggccgcgcgcc----------------------ctctgtcttgtccg
G1QAV8_MCL1-01         ttgaactggacaccgaaaacgaagacaacgtcaaatcttcgtctca--ag
                         *    *                                          

G1P9D2_BCL2L1-01       -----------ggtattggtga---------------------gtcgga-
G1P3J2_BCL2L2-01       -----------gccacttgtgg----------gacaagt----acagga-
G1Q051_BCL2L2-01       -----------gccacttgtgg----------gacaagt----acagga-
G1QEX2_BCL2L10-01      ---------atgccaccgttgac---------------------cagga-
G1PZ39_MCL1-01         cgatcgct-gggctcccgtgggtggaaaccgagacgagcccgggctggaa
G1QAV8_MCL1-01         cgatggttcatgcttttagggacgga----gtgacaaac---ggcagga-
                                  *        *                         *** 

G1P9D2_BCL2L1-01       --------------------------------ttgcaacgtggatggcca
G1P3J2_BCL2L2-01       ---------------------------------------gtggatggtgg
G1Q051_BCL2L2-01       ---------------------------------------gtggacggtgg
G1QEX2_BCL2L10-01      ---------------------------------ctgccagcgcctggtca
G1PZ39_MCL1-01         gggctctccgcccgtttccgaaaccagcatattctggccatgagtcattg
G1QAV8_MCL1-01         -------------------------------------ttgtgactcattt

G1P9D2_BCL2L1-01       ctt-------------acctgaatgaccacct-----------------a
G1P3J2_BCL2L2-01       cct-------------acct-----------------------------g
G1Q051_BCL2L2-01       cct-------------acct-----------------------------g
G1QEX2_BCL2L10-01      cct-------------tcctgtgcagtt--------------ggctcacg
G1PZ39_MCL1-01         tttccgcccacccgattccttgggaaccgctctccgctcaaaggcc-gga
G1QAV8_MCL1-01         ctt--------ttggtgcctttgtagccacttgaagagcataaaccaaga
                         *              ***                              

G1P9D2_BCL2L1-01       gagcct--------------------------------------------
G1P3J2_BCL2L2-01       gagacgcggctggccgac--------------------------------
G1Q051_BCL2L2-01       gagatgcggctggctgac--------------------------------
G1QEX2_BCL2L10-01      gagacgcaccgcacc-----------------------------------
G1PZ39_MCL1-01         aaggtgtgggagacctccaacacttgcca---------------------
G1QAV8_MCL1-01         aagctgcattgaaccgttagcagaagacatcacagatgttctcgtaggga

G1P9D2_BCL2L1-01       -----------tggatccaggagaacggaggctgggacacttttgtggaa
G1P3J2_BCL2L2-01       -----------tggatccacagtagtgggggctgggcggagttcacagct
G1Q051_BCL2L2-01       -----------tggatccacagtattgggggctgggcagagttcacagct
G1QEX2_BCL2L10-01      -----------tggatggaggcgcaaggtggctgggatggcttt-tgtca
G1PZ39_MCL1-01         -----------tggct--tcaa------------ggatgggtttgtggaa
G1QAV8_MCL1-01         cagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaa
                                  *** *                  **     **       

G1P9D2_BCL2L1-01       ctctac------gggaacaacgcagcagccgagagccggaagggccagga
G1P3J2_BCL2L2-01       ctatacggggacggggccctggaggaggctcgacgcctgcgggaggggaa
G1Q051_BCL2L2-01       ctatac---------------------------------------gggaa
G1QEX2_BCL2L10-01      caacttcatg-------cctgcacc-------------gccgcct-gggg
G1PZ39_MCL1-01         ttcttccatgtagaggacctagaag-------------gcggcatcagaa
G1QAV8_MCL1-01         ttcttccaggtggaggacctagaag-------------gcggcgtcagaa

G1P9D2_BCL2L1-01       ac--gcttcaatcgctg-gttcctgacgggcatgactgtg--gctggcgt
G1P3J2_BCL2L2-01       ctgggcctcagtgaggacagtgctgacgggggccgtggcactaggggcct
G1Q051_BCL2L2-01       ctgggcctcagtgaggacagtgctgacgggggccctggcactaagggcct
G1QEX2_BCL2L10-01      acagactgc--tggctccgcttctgagggcatgccttgtactcataatct
G1PZ39_MCL1-01         atgtgctgc--tg-----gcttttgcaggtgttgctggag--taggagct
G1QAV8_MCL1-01         atgtgctgc--tg-----gcttttgcagg---tgctggag--taggagct
                            *  *  *        *  **  **        *           *

G1P9D2_BCL2L1-01       ggttctgc-tgggctcactcttcagtcggaaatga
G1P3J2_BCL2L2-01       tggtaactgtaggagcattttttgctagcaagtga
G1Q051_BCL2L2-01       tgttaactgtaggagcattttttgctagcatgtga
G1QEX2_BCL2L10-01      taatctgcttg---------tggataaaaatcatg
G1PZ39_MCL1-01         ggtttggcata---------tctaataagatag--
G1QAV8_MCL1-01         ggtttgccata---------tctaataaggtag--
                          *     *          *              

© 1998-2022Legal notice