Dataset for CDS BCL-2-like of organism Anas zonorhyncha

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8B9UYC3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL-2 (length=1044 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccctgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggacgagttctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccgcatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggtacgtgccccgtgctttgctttcctgctccgatggcccgtggctggggtggctc
tggggctcacgggtgtccacgtgtgctcacctcggtgcgagcctcgggatgtgaggtttgcctgctgcatctttgcaccg
gtgtgggccttctgctggctcctctgctgtcgggtgtcacctcatggtggggctgcagtgaaacaatgttggtttttaag
tgggggggagcagctgcagctccctcctcaggtgctgaaaggccaagcaaggtgccctctccatcggagggctccgcttt
cccatccccttcacccaccggtggcatcagccctggccaaggcttgttccagcacagcatgggaaggggttacagagtct
ggggatgggtacagggggtggcaggtcctggatgtggacatccctgcatgttggggtgacgcgtgtgtggggacacggtg
ctag
>gnl|bcl2dbcds|A0A8B9UZT1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2A1 (length=519 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcgcaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatatcagttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaaaatttgct
gatggaaatactaattggggaagaattacgaccatatttacttttgggggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagagaagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacttattcgtggctgttttttccttgttcagagagtag
>gnl|bcl2dbcds|A0A8B9V5I0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggctggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9VGG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas zonorhyncha GN=MCL-1 (length=822 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggatttctttcagaccagcacgtaccaaccctttgggatc
agctccgtggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcctgagccagctg
gcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggaatgcttcggaagctggaaatc
aagaaggaggaggacctgcaggccgtgggtgaggtggctgcccacctcttcagcgacggggtgaccaactgggggcgcgt
cgtcaccctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtcaagcaggagaaaagcatcggctccctgg
ccaggatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgac
tttttccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggcgggactgggagcgag
cttggcctacatgatccggtga
© 1998-2022Legal notice