Dataset for CDS BCL-2-like of organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9UZT1_BCL2A1-      --atgga-------------------------aact----gctga-----
A0A8B9VGG9_MCL1-01      ggagggt------gggggacggagtcctggagaaacacgagctggccttc
A0A8B9UYC3_BCL2-01      --atggctcatcccgggagaagaggctacgataaccgggagatag-----
A0A8B9V5I0_BCL2L1-      --atgtc------------------cagcggcaaccgggagctgg-----
                          * *                           **      * *       

A0A8B9UZT1_BCL2A1-      ---------gttctattacgtttatt------------------------
A0A8B9VGG9_MCL1-01      caagggaccggcgagatctgaccatttggggtcagttttgtggaaatcgg
A0A8B9UYC3_BCL2-01      --------tgctgaagtacatccact------------------------
A0A8B9V5I0_BCL2L1-      --------tgatcgactttgtctcct------------------------
                                 *      *        *                        

A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8B9VGG9_MCL1-01      aggcgagctctcagggaccagcaagaattgaccattttgggtcagttcca
A0A8B9UYC3_BCL2-01      --ataaactctcgcagaggggatacgact---------------------
A0A8B9V5I0_BCL2L1-      --acaagctgtcgcagaaaggctacagct---------------------
                                                                          

A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8B9VGG9_MCL1-01      tggaattcagaggcgagtccccggggagtggtgggaactgcccattttgg
A0A8B9UYC3_BCL2-01      ---------gg-----gctgccgg-------cgaggacag----------
A0A8B9V5I0_BCL2L1-      ---------ggagccagctggaggaagaggatgagaacag----------
                                                                          

A0A8B9UZT1_BCL2A1-      ---------------------atttagctcaagat---------------
A0A8B9VGG9_MCL1-01      gtcagttttgtggaactcggaagcgagcccctggggatggggcggaaccg
A0A8B9UYC3_BCL2-01      ----ggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgct
A0A8B9V5I0_BCL2L1-      ----g------------actgagttggcttccgaggccgccgcgg-tgct
                                                  **    *                 

A0A8B9UZT1_BCL2A1-      --tatctgcaatatgtgcttcaggaatc----------------------
A0A8B9VGG9_MCL1-01      accattttggggctgttttcccagaacccagcagcgggatttctttcaga
A0A8B9UYC3_BCL2-01      gctgct---gggactccctcccgccaccgccccgccgggctgctgtcccc
A0A8B9V5I0_BCL2L1-      --caac---gggagcccctcctggcaccccccagccggccaggta-----
                                          * *    * *                      

A0A8B9UZT1_BCL2A1-      acatcttggaccagcgcaaaccagagttgc--------------------
A0A8B9VGG9_MCL1-01      ccagcacgtaccaaccc-tttgggatcagc----------tccgtgggga
A0A8B9UYC3_BCL2-01      gcaccctgagccccccggctcggctgctgctagcgaggcgcccccgggcg
A0A8B9V5I0_BCL2L1-      gtgaacggcgccgccgtgcaccggagcagc---ctggaggtccacgagct
                               *  **  *             **                    

A0A8B9UZT1_BCL2A1-      ---------------------tcatgtcttgcgaaacattgc---atctt
A0A8B9VGG9_MCL1-01      cgggggggagatttgaccattttg------ggctggtttcac-ccaactc
A0A8B9UYC3_BCL2-01      aggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggcc
A0A8B9V5I0_BCL2L1-      cg----ttcaatcgg------ccgccgtccggcaggctctgcgcgaagcc
                                                                 *   *    

A0A8B9UZT1_BCL2A1-      cgctgcaagatcaaacagagg--------aggctctcagacccttcctgg
A0A8B9VGG9_MCL1-01      agaagcgagctcctgagccagctggcggcgagacgccgcc-----cctcc
A0A8B9UYC3_BCL2-01      ggggacgagttctcccgtc-gctaccagcgggacttcgcccagatgtccg
A0A8B9V5I0_BCL2L1-      ggggacgaattcgagctga-ggtaccgccgggctttcagcgacctcacct
                         *   * *  **        *          *    *             

A0A8B9UZT1_BCL2A1-      acaggattgatatcagttctgtagatgttgccaagagaat-tttca----
A0A8B9VGG9_MCL1-01      cgcagcaggatgttgcacttttaaaaaatgcaaaaggaatgcttcggaag
A0A8B9UYC3_BCL2-01      gccagctgcacctgacgcccttcacgg----ccagaggccgcttcg----
A0A8B9V5I0_BCL2L1-      cccagctccacatcacccccggcacggcttaccaga----gcttcg----
                            *    *  *                    *        ***     

A0A8B9UZT1_BCL2A1-      -------------------------atggtgtcatggatgaa--------
A0A8B9VGG9_MCL1-01      ctggaaatcaagaaggaggaggacctgcaggccgtgggtgaggtggctgc
A0A8B9UYC3_BCL2-01      -------------------------tggccgtggtggaggag--------
A0A8B9V5I0_BCL2L1-      -------------------------agcaggtggtgaacgaa--------
                                                      *   **   **         

A0A8B9UZT1_BCL2A1-      ----aaatttgctgatggaaatactaattggggaagaattacgaccatat
A0A8B9VGG9_MCL1-01      ccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctca
A0A8B9UYC3_BCL2-01      ----ctcttccgagacggggtg---aactggggccgcatcgtggccttct
A0A8B9V5I0_BCL2L1-      ----cttttccgcgatggggtg---aactgggggcgcatcgtggccttct
                               **    ** **       ** *****  *  *     ** *  

A0A8B9UZT1_BCL2A1-      ttacttttgg--------gggtcttctcactaagaagcttcaagaacatg
A0A8B9VGG9_MCL1-01      tctccttcggcgccttcgtcgcccggcacctgaaaagcgtcaagca---g
A0A8B9UYC3_BCL2-01      tcgagttcgg------cggcgtcatgtgcgtggagagcgtcaaccg---g
A0A8B9V5I0_BCL2L1-      tctccttcgg------aggggcgctgtgcgtggagagcgtggacaa---g
                        *    ** **          *         *    *** *  *      *

A0A8B9UZT1_BCL2A1-      gagttcagctcactggagagaagaaggagcagatctcttatttcatca--
A0A8B9VGG9_MCL1-01      gaga---------------aaag--------------------catcggc
A0A8B9UYC3_BCL2-01      gagatgtctcccctggtggacag--------------------catcg--
A0A8B9V5I0_BCL2L1-      gagatgagggtcctggtggggcg--------------------catcg--
                        ***                   *                    ****   

A0A8B9UZT1_BCL2A1-      ----cagagtacatcataaacaac-------------------aaagccg
A0A8B9VGG9_MCL1-01      tccctggccaggatcatcaccgac----gccctcgtctcgtccaaacgcg
A0A8B9UYC3_BCL2-01      ----ccgcctggatgaccgagtacctgaaccggcacctg-------caca
A0A8B9V5I0_BCL2L1-      ----tggcctggatgaccacctacctgagcgaccacctc-------gacc
                              *     ** *      **                        * 

A0A8B9UZT1_BCL2A1-      aatggatagatgcaaatggtggctgggaaaat------------------
A0A8B9VGG9_MCL1-01      agtggctcgtgagccagggaggctgggag---------------------
A0A8B9UYC3_BCL2-01      actggatccaggacaacggaggctgggtacgtgccccgtgctttgctttc
A0A8B9V5I0_BCL2L1-      cctggatccaggagaacggcggatgggagc--------------------
                          *** *        * ** ** ****                       

A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      ctgctccgatggcccgtggctggggtggctctggggctcacgggtgtcca
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
                                                                          

A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8B9VGG9_MCL1-01      -----------------------------------ggttt----------
A0A8B9UYC3_BCL2-01      cgtgtgctcacctcggtgcgagcctcgggatgtgaggtttgcctgctgca
A0A8B9V5I0_BCL2L1-      -----------------------------------ggtttgt--------
                                                                          

A0A8B9UZT1_BCL2A1-      ----------------ggcttcct--------------------------
A0A8B9VGG9_MCL1-01      ------------cgtcgactttttccgag---------------------
A0A8B9UYC3_BCL2-01      tctttgcaccggtgtgggccttctgctggctcctctgctgtcgggtgtca
A0A8B9V5I0_BCL2L1-      ----------------ggacctctacggg---------------------
                                        *      *                          

A0A8B9UZT1_BCL2A1-      ----------------------aacaaagtt-------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      cctcatggtggggctgcagtgaaacaatgttggtttttaagtggggggga
A0A8B9V5I0_BCL2L1-      ----------------------aacgatgct-------------------
                                                                          

A0A8B9UZT1_BCL2A1-      --------------------------tgaaaga-----------------
A0A8B9VGG9_MCL1-01      --------------------------tggaagacctggaag-------gc
A0A8B9UYC3_BCL2-01      gcagctgcagctccctcctcaggtgctgaaaggccaagcaaggtgccctc
A0A8B9V5I0_BCL2L1-      ---gctgcgg----------agatgaggaagggccaggaaa-------cc
                                                   * * *                  

A0A8B9UZT1_BCL2A1-      ------agatcact------------------------------------
A0A8B9VGG9_MCL1-01      agcatcaggaacgt------------------------------------
A0A8B9UYC3_BCL2-01      tccatcggagggctccgctttcccatccccttcacccaccggtggcatca
A0A8B9V5I0_BCL2L1-      ttcaacaaatggct------------------------------------
                                     *                                    

A0A8B9UZT1_BCL2A1-      --actgtct---------------------ttctccaaaattacagact-
A0A8B9VGG9_MCL1-01      --gctgatg------------------gcgttcgcaggagtggcgggact
A0A8B9UYC3_BCL2-01      gccctggccaaggcttgttccagcacagcatgggaaggggttacagagtc
A0A8B9V5I0_BCL2L1-      --cctgacc---------------------------ggggccacggtggc
                           ***                                     * *    

A0A8B9UZT1_BCL2A1-      -----------------------tattcgtggctgtt--ttttcct----
A0A8B9VGG9_MCL1-01      gggag------------------cgagcttgg-----------cctaca-
A0A8B9UYC3_BCL2-01      tggggatgggtacagggggtggcaggtcctggatgtggacatccctgcat
A0A8B9V5I0_BCL2L1-      tggag------------------tgctcc----tgctgggatccctgc--
                                                   *               ***    

A0A8B9UZT1_BCL2A1-      -------tgttcagagagtag--------------
A0A8B9VGG9_MCL1-01      -------tgatccg---gtga--------------
A0A8B9UYC3_BCL2-01      gttggggtgacgcgtgtgtggggacacggtgctag
A0A8B9V5I0_BCL2L1-      -------tgagccgcaagtga--------------
                               **    *   **                

© 1998-2022Legal notice