Dataset for CDS BCL2A1 of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5PYQ3_BCL2A1-      atgacagacagtgaatttggatatattcacaatctaactcaggactatct
A0A2K5PYQ3_BCL2A1-      atgacagacagtgaatttggatatattcacaatctaactcaggactatct

A0A2K5PYQ3_BCL2A1-      gtggtacgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
A0A2K5PYQ3_BCL2A1-      gtggtacgtcctgcagataccacaatctggaacgggtccaagcaaaacgt

A0A2K5PYQ3_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaagccatgcttggac
A0A2K5PYQ3_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaagccatgcttggac

A0A2K5PYQ3_BCL2A1-      aatgttaatattgtgtccatagataatgccagaacgatattcagtcaagt
A0A2K5PYQ3_BCL2A1-      aatgttaatattgtgtccatagataatgccagaacgatattcagtcaagt

A0A2K5PYQ3_BCL2A1-      gatggaaacggaatttgaagatggcattattaactggggaagaattgtaa
A0A2K5PYQ3_BCL2A1-      gatggaaacggaatttgaagatggcattattaactggggaagaattgtaa

A0A2K5PYQ3_BCL2A1-      ccatatttgcatttgaaggtattctcatcaagaaacttctacaagagcga
A0A2K5PYQ3_BCL2A1-      ccatatttgcatttgaaggtattctcatcaagaaacttctacaagagcga

A0A2K5PYQ3_BCL2A1-      attgccccggatgtggatacttataaggagatttcgtattttgttgctga
A0A2K5PYQ3_BCL2A1-      attgccccggatgtggatacttataaggagatttcgtattttgttgctga

A0A2K5PYQ3_BCL2A1-      gtacataatgaataacacaggagaatggataagacaaaacggaggct-gg
A0A2K5PYQ3_BCL2A1-      gtacataatgaataacacaggagaatggataagacaaaacggaggctggg
                        *********************************************** **

A0A2K5PYQ3_BCL2A1-      gaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttt
A0A2K5PYQ3_BCL2A1-      ggaaatggc--------acagtctcatgcttatgctagtagagtcagtgg
                        * *******          *** * *  ** *  ** *  *  * * *  

A0A2K5PYQ3_BCL2A1-      tctagaagtcacaggaaagatctgtgaaatgctatctctcttgaagcaat
A0A2K5PYQ3_BCL2A1-      cccagaagaagaggaaaatggctttgtaa---------------------
                         * *****     * ***   ** ** **                     

A0A2K5PYQ3_BCL2A1-      actattga
A0A2K5PYQ3_BCL2A1-      --------

© 1998-2021Legal notice