Dataset for CDS BOK of Organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W5LI71_BOK-01      atggacatgttgcgtcgctcctcagtattcgcggctgaagtgatggaagc
A0A4W5JIY4_BOK-01      atggaggtgattcgtcgctcctctgtgtttgcagccggggtgatggaggc
A0A4W5RX79_BOK-01      atggaggtgattcgtcgctcttctgtgtttgcagccggggtgatggaggc
A0A4W5RX79_BOK-02      atggaggtgattcgtcgctcttctgtgtttgcagccggggtgatggaggc
                       *****  ** * ******** ** ** ** ** ** *  ******** **

A0A4W5LI71_BOK-01      atttgaccgatcccctacagacaaggagctggtgtcacaggcgaaggcgc
A0A4W5JIY4_BOK-01      ctttgaccattccccgtccgacaaagaactggtgtcccagtccaaggcac
A0A4W5RX79_BOK-01      ctttgatcattccccgtcagacaaagaactggtgtccaagtccaaggcac
A0A4W5RX79_BOK-02      ctttgatcattccccgtcagacaaagaactggtgtccaagtccaaggcac
                        ***** *  *****  * ***** ** ********  ** * ***** *

A0A4W5LI71_BOK-01      tatgcagggactacatccattcaaggctgaaccgaaccgggatagggtgg
A0A4W5JIY4_BOK-01      tgtgtagggactacatacactctaggctcaacatctatgggctgggctca
A0A4W5RX79_BOK-01      tgtgtagggactacatacactctaggctcaacctctatgggctaggctcg
A0A4W5RX79_BOK-02      tgtgtagggactacatacactctaggctcaacctctatgggctaggctcg
                       * ** *********** ** ** ***** ***      *** * ** *  

A0A4W5LI71_BOK-01      tccaaacccgagcatcagctgtcagcgtctggtgg----gatgcttggag
A0A4W5JIY4_BOK-01      tccaaaac-------------------tcaggtggactcaacgctttgtg
A0A4W5RX79_BOK-01      tccaaaac-------------------tcaggtggactcaacgctttgtg
A0A4W5RX79_BOK-02      tccaaaac-------------------tcaggtggactcaacgctttgtg
                       ****** *                   ** *****     * **** * *

A0A4W5LI71_BOK-01      aggtatcctctgtcctcatgtggttaggtgatgagttggagtacctgcgg
A0A4W5JIY4_BOK-01      aggtgtctgctgtgcttctctgtctcggtgatgagctggagtgcatgcgg
A0A4W5RX79_BOK-01      atgtggctgctgtgcttctctgtctcggtgatgagctggagtgcatgcgg
A0A4W5RX79_BOK-02      atgtggctgctgtgcttctctgtctcggtgatgagctggagtgcatgcgg
                       * **  *  **** **  * **  * ********* ****** * *****

A0A4W5LI71_BOK-01      cccaacatctaccgtaacgtagctcggcagctgaacatcaccgtggcgtc
A0A4W5JIY4_BOK-01      ccaagtgtctaccggaacgtggcgagacagctcaacatctcagtggccat
A0A4W5RX79_BOK-01      cccagtgtctaccggaacgtggcgagacagctcaacatctcagtagccat
A0A4W5RX79_BOK-02      cccagtgtctaccggaacgtggcgagacagctcaacatctcagtagccat
                       ** *   ******* ***** **  * ***** ****** * ** **   

A0A4W5LI71_BOK-01      tgagagcgtggtgtctgatgccttcctggctgtggctgcagagatcttct
A0A4W5JIY4_BOK-01      ggagaccacggtgtccgatgcctttgttgctgtggcaacagagatatttt
A0A4W5RX79_BOK-01      ggagaccatggtttctgatgccttcgtcgccgtggcaacagagatattcg
A0A4W5RX79_BOK-02      ggagaccatggtttctgatgccttcgtcgccgtggcaacagagatattcg
                        **** *  *** ** ********  * ** *****  ******* **  

A0A4W5LI71_BOK-01      ccac------------------tggtaggtcaattctctgtctgcatctc
A0A4W5JIY4_BOK-01      ctgc----------------------------------------------
A0A4W5RX79_BOK-01      cagcagctcacattccgtcactagtacacacagtttctgctatggatcat
A0A4W5RX79_BOK-02      cagc----------------------------------------------
                       *  *                                              

A0A4W5LI71_BOK-01      tcctc------------aggtataacgtgggggaaggtggtatccctgta
A0A4W5JIY4_BOK-01      -----------------aggcatcacatggggtaaggtagtatctatgta
A0A4W5RX79_BOK-01      gtcactaaagagcgaaaaggtatcacatgggggaaggtggtatctatgta
A0A4W5RX79_BOK-02      -----------------aggtatcacatgggggaaggtggtatctatgta
                                        *** ** ** ***** ***** *****  ****

A0A4W5LI71_BOK-01      tgcggtagctggtgccctggcggtggactgcgtgaggcatggtcacccag
A0A4W5JIY4_BOK-01      tgccgtggccggcgctctggcggtggactgtgtacgtcagaaccagcctg
A0A4W5RX79_BOK-01      tgccgtggctggggctctggcggtggactgcgtgcgacagaaccagccag
A0A4W5RX79_BOK-02      tgccgtggctggggctctggcggtggactgcgtgcgacagaaccagccag
                       *** ** ** ** ** ************** **  * **    ** ** *

A0A4W5LI71_BOK-01      caatggtccacaccattgtagactgcatgggggagtttgtccgcaagagc
A0A4W5JIY4_BOK-01      ctacggtccaaaccatagtggacagtctgggtcagtttgtccgcaagaac
A0A4W5RX79_BOK-01      ctacggtccaaaccatagtggacagcctgggccagtttgtccgcaagaac
A0A4W5RX79_BOK-02      ctacggtccaaaccatagtggacagcctgggccagtttgtccgcaagaac
                       * * ****** ***** ** *** *  ****  *************** *

A0A4W5LI71_BOK-01      ctggtctcctggttgaagaggagaggaggatgggct---gatatcacgaa
A0A4W5JIY4_BOK-01      ctggccccttggctgaagaaacgtggaggatgggtgagtgactggactaa
A0A4W5RX79_BOK-01      ctggccccttggctgaagaaacgcggaggatggacg---gacattaagaa
A0A4W5RX79_BOK-02      ctggccccttggctgaagaaacgcggaggatggacg---gacattaagaa
                       **** * * *** ******   * *********      **    *  **

A0A4W5LI71_BOK-01      gtgcgtggtgaacacagaccccagcttccgctcccattggttgatgtccg
A0A4W5JIY4_BOK-01      atgtgtggtgaagttagatgccgttcctcagacccattggctgtctccag
A0A4W5RX79_BOK-01      gtgtgtggtgaagttagatgccgttcctcagacccattggctgtctcccg
A0A4W5RX79_BOK-02      gtgtgtggtgaagttagatgccgttcctcagacccattggctgtctcccg
                        ** ********   ***  **      *   ******** **    * *

A0A4W5LI71_BOK-01      ctgcctgtgcctgtggacattacctgaaggccatggtgttttacctgctt
A0A4W5JIY4_BOK-01      ttgcccaatcctgcaagcactttctgtcaacactgtacatctacattatg
A0A4W5RX79_BOK-01      ttgcccaatcctgcaagcactttctatcaacactgtacatctacattatg
A0A4W5RX79_BOK-02      ttgcccaatcctgcaagcactttctatcaacactgtacatctacattatg
                        ****    ****    ** *  **     *  **    * *** *  * 

A0A4W5LI71_BOK-01      cgggacaagtaa
A0A4W5JIY4_BOK-01      aaggagccatga
A0A4W5RX79_BOK-01      aaggagccatga
A0A4W5RX79_BOK-02      aaggagccatga
                         ***    * *

© 1998-2023Legal notice