Dataset for CDS MCL-1 of organism Naja naja

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6VLE3_MCL1-01      cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactc
A0A8C6VLE3_MCL1-02      cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactc
                        **************************************************

A0A8C6VLE3_MCL1-01      ccctcctcagaaccaagccgtgctcgaggccggtcgccatgttcaacaag
A0A8C6VLE3_MCL1-02      ccctcctcagaaccaagccgtgctcgaggccggtcgccatgttcaacaag
                        **************************************************

A0A8C6VLE3_MCL1-01      aagacgatggttctgtattgcggcggctccccggattggcaccggccgcc
A0A8C6VLE3_MCL1-02      aagacgatggttctgtattgcggcggctccccggattggcaccggccgcc
                        **************************************************

A0A8C6VLE3_MCL1-01      cctcagtcccccggaggcggcggaggcggcagcggcgagggcggcctggc
A0A8C6VLE3_MCL1-02      cctcagtcccccggaggcggcggaggcggcagcggcgagggcggcctggc
                        **************************************************

A0A8C6VLE3_MCL1-01      tctccttcccggcggcgttcgaggaggcctgggcggggggctctgctggc
A0A8C6VLE3_MCL1-02      tctccttcccggcggcgttcgaggaggcctgggcggggggctctgctggc
                        **************************************************

A0A8C6VLE3_MCL1-01      ctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccg
A0A8C6VLE3_MCL1-02      ctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccg
                        **************************************************

A0A8C6VLE3_MCL1-01      cgcgcagggcccctctcgctgattgggaccagggacgcggccgcgcgcgc
A0A8C6VLE3_MCL1-02      cgcgcagggcccctctcgctgattgggaccagggacgcggccgcgcgcgc
                        **************************************************

A0A8C6VLE3_MCL1-01      actgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
A0A8C6VLE3_MCL1-02      actgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
                        **************************************************

A0A8C6VLE3_MCL1-01      gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcc
A0A8C6VLE3_MCL1-02      gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcc
                        **************************************************

A0A8C6VLE3_MCL1-01      tcttcttcttcccccgccccgccgggagaagccggggacccgctgcgcca
A0A8C6VLE3_MCL1-02      tcttcttcttcccccgccccgccgggagaagccggggacccgctgcgcca
                        **************************************************

A0A8C6VLE3_MCL1-01      ggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccagg
A0A8C6VLE3_MCL1-02      ggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccagg
                        **************************************************

A0A8C6VLE3_MCL1-01      agccccccaagcaggacgactgcggcggcggcgggaagttcctgcagggc
A0A8C6VLE3_MCL1-02      agccccccaagcaggacgactgcggcggcggcgggaagttcctgcagggc
                        **************************************************

A0A8C6VLE3_MCL1-01      ctgctgggccgcttcgggccctgccccgccgaggcggagacggcggctcg
A0A8C6VLE3_MCL1-02      ctgctgggccgcttcgggccctgccccgccgaggcggagacggcggctcg
                        **************************************************

A0A8C6VLE3_MCL1-01      ggccctggagacgctgcggagggtctgcgacgacatcatggagaagcacc
A0A8C6VLE3_MCL1-02      ggccctggagacgctgcggagggtctgcgacgacatcatggagaagcacc
                        **************************************************

A0A8C6VLE3_MCL1-01      agctggccttccaaggaatgctgaggaaagtgcagatcgacaaagctgat
A0A8C6VLE3_MCL1-02      agctggccttccaaggaatgctgaggaaagtgcagatcgacaaagctgat
                        **************************************************

A0A8C6VLE3_MCL1-01      gacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
A0A8C6VLE3_MCL1-02      gacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
                        **************************************************

A0A8C6VLE3_MCL1-01      aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttg
A0A8C6VLE3_MCL1-02      aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttg
                        **************************************************

A0A8C6VLE3_MCL1-01      ccaaacacttgaagagcataaatcaggaaagcggcatcagcactttggca
A0A8C6VLE3_MCL1-02      ccaaacacttgaagagcataaatcaggaaagcggcatcagcactttggca
                        **************************************************

A0A8C6VLE3_MCL1-01      gagatcatcacggaggtgctggtgacagagaagagagagtggctgctgca
A0A8C6VLE3_MCL1-02      gagatcatcacggaggtgctggtgacagagaagagagagtggctgctgca
                        **************************************************

A0A8C6VLE3_MCL1-01      tcacaatgcctggacgggctcgattaaattgcaaaaaagaaaaggaacat
A0A8C6VLE3_MCL1-02      tcacaatgcctgggagggctttgttaaat--------------------t
                        *************  *****   ******                    *

A0A8C6VLE3_MCL1-01      tttgcatgccggaaaaaaagaaaacat--tcaaaaagaaaagaaaagcct
A0A8C6VLE3_MCL1-02      cttccatgtagaggacctggagggcagcatcagaaacattctggtggctt
                         ** ****  *   *    **   **   *** *** *        ** *

A0A8C6VLE3_MCL1-01      ctggagatg------------------attgggaccctccgaagagttaa
A0A8C6VLE3_MCL1-02      ttgcaagtgtggctggcctaggtgcgagcttggcttacttgatccggtga
                         ** *  **                    * **       **   * * *

© 1998-2022Legal notice