Dataset for CDS BOK of Organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SBR3_BOK-01      atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgc
F6SBR3_BOK-02      atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgc
                   ************************************************************

F6SBR3_BOK-01      tcgcccaccgacaaggagctggtggcccaggccaaggcgctcggcagggagtacgtgcac
F6SBR3_BOK-02      tcgcccaccgacaaggagctggtggcccaggccaaggcgctcggcagggagtacgtgcac
                   ************************************************************

F6SBR3_BOK-01      gcgcggctactgcgcgccggcctctcctggagcgcgcccgagcgcgccgcgccgttcccg
F6SBR3_BOK-02      gcgcggctactgcgcgccggcctctcctggagcgcgcccgagcgcgccgcgccgttcccg
                   ************************************************************

F6SBR3_BOK-01      gggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
F6SBR3_BOK-02      gggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
                   ************************************************************

F6SBR3_BOK-01      cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcct
F6SBR3_BOK-02      cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcct
                   ************************************************************

F6SBR3_BOK-01      gtggtgaccgatgcattcttggccgtggccggccacatcttctctgcagg----------
F6SBR3_BOK-02      gtggtgaccgatgcattcttggccgtggccggccacatcttctctgcaggtatgcccagc
                   **************************************************          

F6SBR3_BOK-01      -----catcacgtgggg---caaggtggtgtccttgtatgcggtggccgcagggctggc-
F6SBR3_BOK-02      ctgcccatcccctgggacctcagggagggatc--------tggggtctgcggctcagtct
                        **** * ****    ** ** **  **         ** * * ** *  * * * 

F6SBR3_BOK-01      --cgtggactgcgtgaggcaggcccagcctgccatggtccacgcccttgttgactgcctg
F6SBR3_BOK-02      tacagggaccccacgagccagcccctgcccatcctggc--------------gctgccca
                     *  ****  *  *** *** *** ***   * ***                *****  

F6SBR3_BOK-01      ggagagtttgtgcgcaagaccctgg--ccacctggctgcggaggcgcggtggatggactg
F6SBR3_BOK-02      ---------gtgctca-----ctggtactatctcgct--------gctgtagatgtctgg
                            **** **     ****  * * ** ***        ** ** ****    *

F6SBR3_BOK-01      atgtcctcaagtgtgtggtcaacacagaccct--ggcctccgctcccactggctgctcgc
F6SBR3_BOK-02      aactgccca-----gtgaccagtgcggatcctcaggactcaaactaca------------
                   *  * * **     ***  **   * ** ***  ** ***      **            

F6SBR3_BOK-01      cgcactctgcagctttggccgcttcctgaaggctgcc---ttcttcgtgctcctgccaga
F6SBR3_BOK-02      -gcattcagggtctctcgtgg--ttctgtgggttggcgggcacgctgggcagctggcaca
                    *** ** *   ** * *  *  * ***  ** ** *     *   * **  *** ** *

F6SBR3_BOK-01      ga---gatga
F6SBR3_BOK-02      ggcttcttga
                   *      ***

© 1998-2020Legal notice