Dataset for CDS BOK of Organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F6SBR3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Callithrix jacchus GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcctgtggtgaccgatgcattctt
ggccgtggccggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccttgtatgcggtggccgcagggctgg
ccgtggactgcgtgaggcaggcccagcctgccatggtccacgcccttgttgactgcctgggagagtttgtgcgcaagacc
ctggccacctggctgcggaggcgcggtggatggactgatgtcctcaagtgtgtggtcaacacagaccctggcctccgctc
ccactggctgctcgccgcactctgcagctttggccgcttcctgaaggctgccttcttcgtgctcctgccagagagatga
>gnl|bcl2dbcds|F6SBR3_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Callithrix jacchus GN=BOK (length=606 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcctgtggtgaccgatgcattctt
ggccgtggccggccacatcttctctgcaggtatgcccagcctgcccatcccctgggacctcagggagggatctggggtct
gcggctcagtcttacagggaccccacgagccagcccctgcccatcctggcgctgcccagtgctcactggtactatctcgc
tgctgtagatgtctggaactgcccagtgaccagtgcggatcctcaggactcaaactacagcattcagggtctctcgtggt
tctgtgggttggcgggcacgctgggcagctggcacaggcttcttga
© 1998-2020Legal notice