Dataset for CDS BCL-2-like of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      -----------------------------------atg----actgactg
A0A2K6G3I7_BCL2-01      -----------------------------------atg-----gcgcacg
A0A2K6F2Q2_BCL2L10      -----------------------------------atg----ggtgacc-
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      -----------------------------------atg----tttggcct
A0A2K6GI15_MCL1-02      -----------------------------------atg----tttggcct
A0A2K6GI15_MCL1-03      -----------------------------------atg----tttggcct
A0A2K6G3C5_BCL2L1-      ttcccagaaaggatacagctggagtcagtttatcgatgcagaagagaaca
A0A2K6G3C5_BCL2L1-      -----------------------------------atgcagaagagaaca
A0A2K6GWM6_BCL2L2-      -----------------------------------atg-----gcggcgg
A0A2K6GWM6_BCL2L2-      -----------------------------------atg-----gcggcgg
A0A2K6GWM6_BCL2L2-      -----------------------------------atg-----gcgaccc
A0A2K6GWM6_BCL2L2-      -----------------------------------atg-----gcgaccc

A0A2K6EKG1_BCL2A1-      t---------gagtttggatacacccaca---------------------
A0A2K6G3I7_BCL2-01      ccgggagaacagggtatgataaccgggagatagtgatgaagtacatccat
A0A2K6F2Q2_BCL2L10      ------------ggttcagggagcgcacc---------------------
A0A2K6F6N9_MCL1-01      -------------------------gat----------------------
A0A2K6GI15_MCL1-01      c-----aaaagaaacgcggtaatcggact---------------------
A0A2K6GI15_MCL1-02      c-----aaaagaaacgcggtaatcggact---------------------
A0A2K6GI15_MCL1-03      c-----aaaagaaacgcggtaatcggact---------------------
A0A2K6G3C5_BCL2L1-      g-----gactgaggccc------cagaag---------------------
A0A2K6G3C5_BCL2L1-      g-----gactgaggccc------cagaag---------------------
A0A2K6GWM6_BCL2L2-      c-----ggcggcggcgg------cagcag---------------------
A0A2K6GWM6_BCL2L2-      c-----ggcggcggcgg------cagcag---------------------
A0A2K6GWM6_BCL2L2-      c-----agcctcagccc------cagaca---------------------
A0A2K6GWM6_BCL2L2-      c-----agcctcagccc------cagaca---------------------

A0A2K6EKG1_BCL2A1-      ----ggctggtccag---gactacctgcagtacgtcctgcgggttccgca
A0A2K6G3I7_BCL2-01      tataagctggcgcagaggggctac--gagtgggatgccggagacgcgggc
A0A2K6F2Q2_BCL2L10      ---gagcggctgctggccgactacc----tggagtactgcacaagggagc
A0A2K6F6N9_MCL1-01      ------------ctgtggattaacc----tggggatcagctg--------
A0A2K6GI15_MCL1-01      ---caacctctactgtgggggggccggattgggggccggcagcagcggcg
A0A2K6GI15_MCL1-02      ---caacctctactgtgggggggccggattgggggccggcagcagcggcg
A0A2K6GI15_MCL1-03      ---caacctctactgtgggggggccggattgggggccggcagcagcggcg
A0A2K6G3C5_BCL2L1-      ---cgactgaatcggaga--------tggagacccccagtgccattaatg
A0A2K6G3C5_BCL2L1-      ---cgactgaatcggaga--------tggagacccccagtgccattaatg
A0A2K6GWM6_BCL2L2-      ---cagcgggggctgcgggcggtc----ggggctccgggccggggcggcg
A0A2K6GWM6_BCL2L2-      ---cagcgggggctgcgggcggtc----ggggctccgggccggggcggcg
A0A2K6GWM6_BCL2L2-      ---ca-cgggctctggtggcagactttgtaggctataagctgaggcagaa
A0A2K6GWM6_BCL2L2-      ---ca-cgggctctggtggcagactttgtaggctataagctgaggcagaa
                                    * *                       *           

A0A2K6EKG1_BCL2A1-      gc------------------------------------------------
A0A2K6G3I7_BCL2-01      gctgcgcccccgggggccgcccccacgccgggcatcttctcctcccagcc
A0A2K6F2Q2_BCL2L10      cgggcgccccggggctgccgccgtc-------------------------
A0A2K6F6N9_MCL1-01      ---------cgggcgggcagatctaggc----------------------
A0A2K6GI15_MCL1-01      ccacccccccgggagggcggcttttggctgccgagaaggaggccacggcc
A0A2K6GI15_MCL1-02      ccacccccccgggagggcggcttttggctgccgagaaggaggccacggcc
A0A2K6GI15_MCL1-03      ccacccccccgggagggcggctttt-------------------------
A0A2K6G3C5_BCL2L1-      gcaacccatcctggcacctggcgga-------------------------
A0A2K6G3C5_BCL2L1-      gcaacccatcct--------------------------------------
A0A2K6GWM6_BCL2L2-      gcgccatct-tgtgcccggggc----------------------------
A0A2K6GWM6_BCL2L2-      gcgccatct-tgtgcccggggc----------------------------
A0A2K6GWM6_BCL2L2-      gggttatgtctgtggagctggc----------------------------
A0A2K6GWM6_BCL2L2-      gggttatgtctgtggagctggc----------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      cgg-----------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      cggcgagaggtagggggaggggaagacggcacggtgattggcggaagccc
A0A2K6GI15_MCL1-02      cggcgagaggtagggggaggggaagacggcacggtgattggcggaagccc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      cggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgc
A0A2K6GI15_MCL1-02      cggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggccggctcccattggtgccgaagtccccgacgtcaccgcgaccccggag
A0A2K6GI15_MCL1-02      ggccggctcccattggtgccgaagtccccgacgtcaccgcgaccccggag
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      aggctgctgttcttcgcgcccacccgccgcgcattgccgtccgaggagat
A0A2K6GI15_MCL1-02      aggctgctgttcttcgcgcccacccgccgcgcattgccgtccgaggagat
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacg
A0A2K6GI15_MCL1-02      ggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacg
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggtacgagccggagcctctcgggaagcggccggctgtcctgcctttgctg
A0A2K6GI15_MCL1-02      ggtacgagccggagcctctcgggaagcggccggctgtcctgcctttgctg
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      gagttggtcggggaggccagtaatggctccagcacggacgggtcactacc
A0A2K6GI15_MCL1-02      gagttggtcggggaggccagtaatggctccagcacggacgggtcactacc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      ------------------------------------------gcgcaacc
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagt
A0A2K6GI15_MCL1-02      ctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagt
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      cccctcccgctgcgcctcgggacccggccgccaggacctcgcccccgccc
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      cgctggagattatctctcggtaccttcgggagcaggcaaccggcgccaag
A0A2K6GI15_MCL1-02      cgctggagattatctctcggtaccttcgggagcaggcaaccggcgccaag
A0A2K6GI15_MCL1-03      ----------------------------------ggcaaccggcgccaag
A0A2K6G3C5_BCL2L1-      ------------------------cagccccccagcgaatggagccactg
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      ----------ccgggtccggtccgagcaagacgtccagagtgctgcaaaa
A0A2K6G3I7_BCL2-01      gccgccgccgcggggcctgcgcccagcccggtgccacctgtggtccacct
A0A2K6F2Q2_BCL2L10      -----------------ctcgctcgaggccgcc-----------------
A0A2K6F6N9_MCL1-01      -------------tgggcctggctgggttt--------------------
A0A2K6GI15_MCL1-01      gacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctaga
A0A2K6GI15_MCL1-02      gacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctaga
A0A2K6GI15_MCL1-03      gacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctaga
A0A2K6G3C5_BCL2L1-      gccacagcagcagtttggatgcccgggaggtgatccccatggcagcagtg
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      ----------cggtggggaggccggggagggggccccggggggcgcaggg
A0A2K6GWM6_BCL2L2-      ----------cggtggggaggccggggagggggccccggggggcgcaggg
A0A2K6GWM6_BCL2L2-      ----------ccgggggagggcccagcagctgaccc-----gctgcacca
A0A2K6GWM6_BCL2L2-      ----------ccgggggagggcccagcagctgaccc-----gctgcacca

A0A2K6EKG1_BCL2A1-      cattg-----ccttctccgtccaaaacgaagtcgaaaagaa---------
A0A2K6G3I7_BCL2-01      gaccc-----tccgccaggcgggcgatgacttctcccgccgctaccgccg
A0A2K6F2Q2_BCL2L10      -gcga-----tgcgcttcgcagccaccaagatacggcggaagcacgcgtc
A0A2K6F6N9_MCL1-01      -----------------------------------------------gaa
A0A2K6GI15_MCL1-01      gacct-----tacgacgtgtcggggacggtgtgcagcgcaaccacgagac
A0A2K6GI15_MCL1-02      gacct-----tacgacgtgtcggggacggtgtgcagcgcaaccacgagac
A0A2K6GI15_MCL1-03      gacct-----tacgacgtgtcggggacggtgtgcagcgcaaccacgagac
A0A2K6G3C5_BCL2L1-      aagcaagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcg
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      gacta-----cgggaacggcctg----gagtctgag--------------
A0A2K6GWM6_BCL2L2-      gacta-----cgggaacggcctg----gagtctgag--------------
A0A2K6GWM6_BCL2L2-      agcca-----tgcgggcagctggagatgagtttgagacccgcttccggcg
A0A2K6GWM6_BCL2L2-      agcca-----tgcgggcagctggagatgagtttgagacccgcttccggcg

A0A2K6EKG1_BCL2A1-      ----tctgaaagcatg---cttggacaatgttaatgtggcgtccat----
A0A2K6G3I7_BCL2-01      cgacttcgccgagatg---tccagccagc-tgcacctgacgccctt----
A0A2K6F2Q2_BCL2L10      cttcttctcc-gccta---cgtcggctac-c-----------ccgg----
A0A2K6F6N9_MCL1-01      ggccttccaaggcatg---cttcagaaac-tggacatcaaaaacga----
A0A2K6GI15_MCL1-01      ggccttccaa----------------------------------------
A0A2K6GI15_MCL1-02      ggccttccaaggcatg---cttcggaaac-tggacatcaaaaacga----
A0A2K6GI15_MCL1-03      ggccttccaaggcatg---cttcggaaac-tggacatcaaaaacga----
A0A2K6G3C5_BCL2L1-      ggcattcagtgacctgacatcc---cagc-tccacatcaccctagg----
A0A2K6G3C5_BCL2L1-      --------------------------------------------gg----
A0A2K6GWM6_BCL2L2-      ----------gaactggagcctggggagc-tgctgctggagcccgagccg
A0A2K6GWM6_BCL2L2-      ----------gaactggagcctgggga-----------------------
A0A2K6GWM6_BCL2L2-      taccttctctgatctggcggct---cagc-tgcatgtgacccccgg----
A0A2K6GWM6_BCL2L2-      taccttctctgatctggcggct---cagc-tgcatgtgacccccgg----

A0A2K6EKG1_BCL2A1-      -----agatgccgccagaacgatattcaatcaagtgatggaaaaggaatt
A0A2K6G3I7_BCL2-01      ----caccgcgaggggacgct---ttgccac-ggtggtggaggagctctt
A0A2K6F2Q2_BCL2L10      -----gaaccgcgtctacctg---ctggagcggatggcggaggccgtgct
A0A2K6F6N9_MCL1-01      -----agacgatgtcaaatct---ttatcacgagtgatggtccatgtttt
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      -----agacgatgtcaaatct---ttgtctcgagtgatggtccatgtttt
A0A2K6GI15_MCL1-03      -----agacgatgtcaaatct---ttgtctcgagtgatggtccatgtttt
A0A2K6G3C5_BCL2L1-      ----gacagcatatcagagct---ttg-aacaggtagtgaatgaactctt
A0A2K6G3C5_BCL2L1-      ----gacagcatatcagagct---ttg-aacaggtagtgaatgaactctt
A0A2K6GWM6_BCL2L2-      gagcccgagcccgaagaggag---ccg-ccccggcccc------gcgccc
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      ----ctcagcccagcagcgct---tca-cccaggtctccgatgaactttt
A0A2K6GWM6_BCL2L2-      ----ctcagcccagcagcgct---tca-cccaggtctccgatgaactttt

A0A2K6EKG1_BCL2A1-      tgaagatggcatcgttaactggggaaggattgtgaccgtgtttgcattcg
A0A2K6G3I7_BCL2-01      cagggatggggt---gaactgggggaggattgtggccttctttgagttcg
A0A2K6F2Q2_BCL2L10      ctgcgacagcct---cagctggggccgggtagtgatgctcgtgaccttcg
A0A2K6F6N9_MCL1-01      cagtgacagcgtaacaaactggggcaggattgtgactttaatttctttt-
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      cagtgacggcgtaacaaactggggcaggattgtgactctaatttctttt-
A0A2K6GI15_MCL1-03      cagtgacggcgtaacaaactggggcaggattgtgactctaatttctttt-
A0A2K6G3C5_BCL2L1-      ccgagatggggt---aaactggggtcgcattgtggcctttttctccttcg
A0A2K6G3C5_BCL2L1-      ccgagatggggt---aaactggggtcgcattgtggcctttttctccttcg
A0A2K6GWM6_BCL2L2-      ccccgggagctc---cg----------------ggccctggtcctggctc
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      ccaagggggccc---caactggggccgccttgtggccttcttcgtctttg
A0A2K6GWM6_BCL2L2-      ccaagggggccc---caactggggccgccttgtggccttcttcgtctttg

A0A2K6EKG1_BCL2A1-      gaggtattctcat-------------------------------------
A0A2K6G3I7_BCL2-01      gtggggtcatgt-----------------gtgtggagagcgtcaa-----
A0A2K6F2Q2_BCL2L10      cagggacgcttctagagagagggccgccggtgaccgcctggtggaagaag
A0A2K6F6N9_MCL1-01      ----tgtgccttt----------------gtgtccaaacacttgaaga--
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      ----ggtgccttt----------------gtggccaaacacttgaaga--
A0A2K6GI15_MCL1-03      ----ggtgccttt----------------gtggccaaacacttgaaga--
A0A2K6G3C5_BCL2L1-      gcggggccctct-----------------gcgtcgaaagcgtaga-----
A0A2K6G3C5_BCL2L1-      gcggggccctct-----------------gcgtcgaaagcgtaga-----
A0A2K6GWM6_BCL2L2-      gggagcccccgg-----------------cagccaggag-----------
A0A2K6GWM6_BCL2L2-      --------------------------------ccaggag-----------
A0A2K6GWM6_BCL2L2-      gggctgcactgt-----------------gtgctgagagtgtcaa-----
A0A2K6GWM6_BCL2L2-      gggctgcactgt-----------------gtgctgagagtgtcaa-----

A0A2K6EKG1_BCL2A1-      --------------------caagaaa------cttctacgagagcagat
A0A2K6G3I7_BCL2-01      --------------------ccgggagatgtcgcccctggtggacaacat
A0A2K6F2Q2_BCL2L10      tggggcctccagccgcagccgaaggagggggatcccgaagtcgcccggga
A0A2K6F6N9_MCL1-01      ------------ccataaaccaag------------agagctgcatcgaa
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      ------------gcataaaccaag------------aaagctgcatcgaa
A0A2K6GI15_MCL1-03      ------------gcataaaccaag------------aaagctgcatcgaa
A0A2K6G3C5_BCL2L1-      --------------------caaggagatgcaggtattggtgagtcggat
A0A2K6G3C5_BCL2L1-      --------------------caaggagatgcaggtattggtgagtcggat
A0A2K6GWM6_BCL2L2-      ---------------------gaggaggaggagcc------gggac----
A0A2K6GWM6_BCL2L2-      ---------------------gaggaggaggagcc------gggac----
A0A2K6GWM6_BCL2L2-      --------------------caaggagatggagccactggtgggacaagt
A0A2K6GWM6_BCL2L2-      --------------------caaggagatggagccactggtgggacaagt

A0A2K6EKG1_BCL2A1-      tgccctggatgtggatacttacaaggagatttcttattttatt-------
A0A2K6G3I7_BCL2-01      cgccctgtggatgactgagtacctg-------------------------
A0A2K6F2Q2_BCL2L10      ccgccagcgcctggtggccctgctgtgcgcccggct--------------
A0A2K6F6N9_MCL1-01      ccattagcagaaagtatcacagacat-------tct--------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      ccattagcagaaagtatcacagacgt-------tct--------------
A0A2K6GI15_MCL1-03      ccattagcagaaagtatcacagacgt-------tct--------------
A0A2K6G3C5_BCL2L1-      cgcaacttggatggccacttacctg-------------------------
A0A2K6G3C5_BCL2L1-      cgcaacttggatggccacttacctg-------------------------
A0A2K6GWM6_BCL2L2-      ----tggtcgagggtgac---ccgggggacggcgc---------------
A0A2K6GWM6_BCL2L2-      ----tggtcgagggtgac---ccgggggacggcgc---------------
A0A2K6GWM6_BCL2L2-      gcaggagtggatggtggcctacctggagacacggctggccgactggatcc
A0A2K6GWM6_BCL2L2-      gcaggagtggatggtggcctacctggagacacggctggccgactggatcc

A0A2K6EKG1_BCL2A1-      -----gctgagttcataacgaataacgcagg--------------agagt
A0A2K6G3I7_BCL2-01      -----aaccggcacctgca--------------------------cacct
A0A2K6F2Q2_BCL2L10      -----ggcggggcagcaccg-------------------------cgcct
A0A2K6F6N9_MCL1-01      -----tgtaaggacgaaacg-------------------------agact
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      -----tgtaaggacaaaacg-------------------------agact
A0A2K6GI15_MCL1-03      -----tgtaaggacaaaacg-------------------------agact
A0A2K6G3C5_BCL2L1-      -----aatgaccacctagagc---------------ctt------ggatc
A0A2K6G3C5_BCL2L1-      -----aatgaccacctagagc---------------ctt------ggatc
A0A2K6GWM6_BCL2L2-      ----cattgaggacccggagctggaagccatcaaagctc------gggtc
A0A2K6GWM6_BCL2L2-      ----cattgaggacccggagctggaagccatcaaagctc------gggtc
A0A2K6GWM6_BCL2L2-      acagcagtgggggctgggagctggaagccatcaaagctc------gggtc
A0A2K6GWM6_BCL2L2-      acagcagtgggggctgggcg------gagttcacagctctatacggggac

A0A2K6EKG1_BCL2A1-      ggatacggcagaacggaggctgggaaca----------------------
A0A2K6G3I7_BCL2-01      ggatccaggataacggaggctggga-------------------------
A0A2K6F2Q2_BCL2L10      ggctgcaggctcaaggcggctggga-------------------------
A0A2K6F6N9_MCL1-01      ggcta---------------------------------------------
A0A2K6GI15_MCL1-01      ----------------------gga-------------------------
A0A2K6GI15_MCL1-02      ggctagtcaaacaaagaggctggga-------------------------
A0A2K6GI15_MCL1-03      ggctagtcaaacaaagaggctggga-------------------------
A0A2K6G3C5_BCL2L1-      caggaga-----acggcggctggga-------------------------
A0A2K6G3C5_BCL2L1-      caggaga-----acggcggctggga-------------------------
A0A2K6GWM6_BCL2L2-      agggagatggaggaagaagctgagaagttaaaagagctacagaacgaggt
A0A2K6GWM6_BCL2L2-      agggagatggaggaagaagctgagaagttaaaagagctacagaacgaggt
A0A2K6GWM6_BCL2L2-      agggagatggaggaagaagctgagaagttaaaagagctacagaacgaggt
A0A2K6GWM6_BCL2L2-      ggggccctggaggagg----------------------------cgcgg-

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      agagaagcagatgaatatgagtccacctccaggcaatgctggtccagtga
A0A2K6GWM6_BCL2L2-      agagaagcagatgaatatgagtccacctccaggcaatgctggtccagtga
A0A2K6GWM6_BCL2L2-      agagaagcagatgaatatgagtccacctccaggcaatgctggtccagtga
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      -cggcttcgtaaag------------------------------------
A0A2K6G3I7_BCL2-01      -cgcctttgtggaa---------------------------ttgtatggt
A0A2K6F2Q2_BCL2L10      -tggcttttgtgac------------------------ttattc-----a
A0A2K6F6N9_MCL1-01      --------------------------------------ttcttccatgta
A0A2K6GI15_MCL1-01      -tgggtttgtggag------------------------ttcttccatgta
A0A2K6GI15_MCL1-02      -tgggtttgtggag------------------------ttcttccatgta
A0A2K6GI15_MCL1-03      -tgggtttgtggag------------------------ttcttccatgta
A0A2K6G3C5_BCL2L1-      -cacttttgtggaa---------------------------ctctacgga
A0A2K6G3C5_BCL2L1-      -cacttttgtggaa---------------------------ctctacgga
A0A2K6GWM6_BCL2L2-      tcatgtccattgaagagaaaatggaggctgatgcccgttccatctatgtt
A0A2K6GWM6_BCL2L2-      tcatgtccattgaagagaaaatggaggctgatgcccgttccatctatgtt
A0A2K6GWM6_BCL2L2-      tcatgtccattgaagagaaaatggaggctgatgcccgttccatctatgtt
A0A2K6GWM6_BCL2L2-      ---cgtctgcgggaggggaactggg---------------catcagtgag

A0A2K6EKG1_BCL2A1-      --aagtttgaac-------ctagacctgcctggctgacttttctg-----
A0A2K6G3I7_BCL2-01      cccagcatgcg------------------gcctctgtttgatttc-----
A0A2K6F2Q2_BCL2L10      ggaaacc-------------------cttgccgctagctgtttgg-----
A0A2K6F6N9_MCL1-01      gaagacctggaaggcagcatcagaaatgtgctgctggct-tttgc-----
A0A2K6GI15_MCL1-01      gaggacctagaaggcggcatcagaaatgtgctgctggct-tttgc-----
A0A2K6GI15_MCL1-02      gaggacctagaaggcggcatcagaaatgtgctgctggct-tttgc-----
A0A2K6GI15_MCL1-03      gaggacctagaaggcggcatcagaaatgtgctgctggct-tttgc-----
A0A2K6G3C5_BCL2L1-      aacaatg------------cagcagctg-agagccggaag----------
A0A2K6G3C5_BCL2L1-      aacaatg------------cagcagctg-agagccggaag----------
A0A2K6GWM6_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctggaagctcactttca
A0A2K6GWM6_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctggaagctcactttca
A0A2K6GWM6_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctggaagctcactttca
A0A2K6GWM6_BCL2L2-      gacagtgctga--------caggggccgtggcactgggggccc-------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -------------------------------------------------g
A0A2K6G3C5_BCL2L1-      -------------------------------------------------g
A0A2K6GWM6_BCL2L2-      tggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtg
A0A2K6GWM6_BCL2L2-      tggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtg
A0A2K6GWM6_BCL2L2-      tggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtg
A0A2K6GWM6_BCL2L2-      ------------------------------------tggtaactgtaggg

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      gcc-----------------------------------------------
A0A2K6G3C5_BCL2L1-      gcc-----------------------------------------------
A0A2K6GWM6_BCL2L2-      gccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtg
A0A2K6GWM6_BCL2L2-      gccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtg
A0A2K6GWM6_BCL2L2-      gccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtg
A0A2K6GWM6_BCL2L2-      gcc-----------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      aggacttccctggccttagatgagtccctgtttagaggaagacaaatca-
A0A2K6GWM6_BCL2L2-      aggacttccctggccttagatgagtccctgtttagaggaagacaaatca-
A0A2K6GWM6_BCL2L2-      aggacttccctggccttagatgagtccctgtttagaggaagacaaatcaa
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------aggaga------
A0A2K6F6N9_MCL1-01      --------------------------------------tggtg-------
A0A2K6GI15_MCL1-01      --------------------------------------aggtg-------
A0A2K6GI15_MCL1-02      --------------------------------------aggtg-------
A0A2K6GI15_MCL1-03      --------------------------------------aggtg-------
A0A2K6G3C5_BCL2L1-      --------------------------------------agg---------
A0A2K6G3C5_BCL2L1-      --------------------------------------agg---------
A0A2K6GWM6_BCL2L2-      --------------------------------------aggtgatcccaa
A0A2K6GWM6_BCL2L2-      --------------------------------------aggtgatcccaa
A0A2K6GWM6_BCL2L2-      ggtaagcctgtgctttccattgtacatcctttactctcaggtgatcccaa
A0A2K6GWM6_BCL2L2-      --------------------------tttttcgctagcaagtga------

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6G3I7_BCL2-01      ----------------------------------tcctggctgtctctga
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      aacgcttcaaccgct-----------------------ggttcctgacgg
A0A2K6G3C5_BCL2L1-      aacgcttcaaccgct-----------------------ggttcctgacgg
A0A2K6GWM6_BCL2L2-      aacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacga
A0A2K6GWM6_BCL2L2-      aacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacga
A0A2K6GWM6_BCL2L2-      aacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacga
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      -gaagttacgggg-------------------------------------
A0A2K6G3I7_BCL2-01      agactctgctcagcctgg--------------------------------
A0A2K6F2Q2_BCL2L10      -----ctgctggtccagg--------------------------------
A0A2K6F6N9_MCL1-01      -----ttgctggagtagg--------------------------------
A0A2K6GI15_MCL1-01      -----ttgctggagtagg--------------------------------
A0A2K6GI15_MCL1-02      -----ttgctggagtagg--------------------------------
A0A2K6GI15_MCL1-03      -----ttgctggagtagg--------------------------------
A0A2K6G3C5_BCL2L1-      gcatg--actgtggctgg--------------------------------
A0A2K6G3C5_BCL2L1-      gcatg--actgtggctgg--------------------------------
A0A2K6GWM6_BCL2L2-      gcccgctaccgtgcccggactaccaactacaacagttcccgctctcgatt
A0A2K6GWM6_BCL2L2-      gcccgctaccgtgcccggactaccaactacaacagttcccgctctcgatt
A0A2K6GWM6_BCL2L2-      gcccgctaccgtgcccggactaccaactacaacagttcccgctctcgatt
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      ----aagatctgtgacatgctgtccctcctctactcctga----------
A0A2K6G3I7_BCL2-01      ---------ccctggtgggagcttgcatcaccctgggtgcctatctgggc
A0A2K6F2Q2_BCL2L10      ----ttct--tttgtcatgctttttagcaacgaccgtcatctatttctgg
A0A2K6F6N9_MCL1-01      ----agctggtttgactt--------------------atcta-------
A0A2K6GI15_MCL1-01      ----agctggtttggcat--------------------atcta-------
A0A2K6GI15_MCL1-02      ----agctggtttggcat--------------------atcta-------
A0A2K6GI15_MCL1-03      ----agctggtttggcat--------------------atcta-------
A0A2K6G3C5_BCL2L1-      ----cgtggttctg----------ctgggctcgctctt--------cagt
A0A2K6G3C5_BCL2L1-      ----cgtggttctg----------ctgggctcgctctt--------cagt
A0A2K6GWM6_BCL2L2-      ctacagtggttttaacagcaggccccggggtcgcgtctacaggggccggg
A0A2K6GWM6_BCL2L2-      ctacagtggttttaacagcaggccccggggtcgcgtctacaggggccggg
A0A2K6GWM6_BCL2L2-      ctacagtggttttaacagcaggccccggggtcgcgtctacaggggccggg
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6EKG1_BCL2A1-      --------------------------------
A0A2K6G3I7_BCL2-01      cacaagtga-----------------------
A0A2K6F2Q2_BCL2L10      acacgatta--ttatga---------------
A0A2K6F6N9_MCL1-01      ataagatag-----------------------
A0A2K6GI15_MCL1-01      ataagatagccttgtaa---------------
A0A2K6GI15_MCL1-02      ataagatag-----------------------
A0A2K6GI15_MCL1-03      ataagatag-----------------------
A0A2K6G3C5_BCL2L1-      cggaaatga-----------------------
A0A2K6G3C5_BCL2L1-      cggaaatga-----------------------
A0A2K6GWM6_BCL2L2-      ctagagcgacatcatggtattccccttactaa
A0A2K6GWM6_BCL2L2-      ctagagcgacatcatggtattccccttactaa
A0A2K6GWM6_BCL2L2-      ctagagcgacatcatggtattccccttactaa
A0A2K6GWM6_BCL2L2-      --------------------------------

© 1998-2023Legal notice