Dataset for CDS BCL-2-like of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6EKG1_BCL2A1-      atgactgactgtgagtttggat------acacccacaggctggtccagga
A0A2K6GI15_MCL1-01      atgttt---------------ggcctcaaaagaaacgcggtaatcggact
A0A2K6F6N9_MCL1-01      ----------------------------------------------gat-
A0A2K6GI15_MCL1-03      atgttt---------------ggcctcaaaagaaacgcggtaatcggact
A0A2K6F2Q2_BCL2L10      atgggt---gaccggttcagggagcgcaccgagcgg---ctgctggccga
A0A2K6G3I7_BCL2-01      atggcgcacgccgggagaacagggtatgataaccgggagatagtgatgaa
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      atg------------------tctcagagcaaccgggagctggtggttga
A0A2K6GWM6_BCL2L2-      atggcg---accccagcctcagccccagacacacgggctctggtggcaga
A0A2K6GWM6_BCL2L2-      atggcg---accccagcctcagccccagacacacgggctctggtggcaga
                                                                          

A0A2K6EKG1_BCL2A1-      ctacctgcagtacgtcct--------------------------------
A0A2K6GI15_MCL1-01      caacctctactgtggg----------------------------------
A0A2K6F6N9_MCL1-01      ---------ctgtgga----------------------------------
A0A2K6GI15_MCL1-03      caacctctactgtggg----------------------------------
A0A2K6F2Q2_BCL2L10      ctacctggagtac-------------------------------------
A0A2K6G3I7_BCL2-01      gtacatccattataagct--------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A2K6GWM6_BCL2L2-      ctttgtaggctataagct--------------------------------
A0A2K6GWM6_BCL2L2-      ctttgtaggctataagct--------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      ---------------------------gcggg-----------ttccgca
A0A2K6GI15_MCL1-01      ------------------------ggggccgg------------------
A0A2K6F6N9_MCL1-01      ------------------------ttaacc--------------------
A0A2K6GI15_MCL1-03      ------------------------ggggccgg------------------
A0A2K6F2Q2_BCL2L10      ----tgcacaag------------ggagccgg---------------gcg
A0A2K6G3I7_BCL2-01      --ggcgcagaggggctacgagtgggatgccggagacgcgggcgctgcgcc
A0A2K6G3C5_BCL2L1-      ---atgcagaag------------agaacagg------------------
A0A2K6G3C5_BCL2L1-      tcgatgcagaag------------agaacagg------------------
A0A2K6GWM6_BCL2L2-      --gaggcagaagggttatgtctgtggagctgg------------------
A0A2K6GWM6_BCL2L2-      --gaggcagaagggttatgtctgtggagctgg------------------
                                                    *                     

A0A2K6EKG1_BCL2A1-      gcccgggtccggtcc-----------------------gagcaagacg--
A0A2K6GI15_MCL1-01      attgggggccggc---------agcagcggcgccacccccccgggagggc
A0A2K6F6N9_MCL1-01      --tggggatcagc---------tg-----------------cgggcgggc
A0A2K6GI15_MCL1-03      attgggggccggc---------agcagcggcgccacccccccgggagggc
A0A2K6F2Q2_BCL2L10      ccccggggctgccgc------------------cgtcctcgctcgagg--
A0A2K6G3I7_BCL2-01      cccgggggccgcccccacgccgggcatcttctcctcccagcccgggcgca
A0A2K6G3C5_BCL2L1-      act----gaggcccc-------agaagcgactgaatcggagatggaga--
A0A2K6G3C5_BCL2L1-      act----gaggcccc-------agaagcgactgaatcggagatggaga--
A0A2K6GWM6_BCL2L2-      cccgggggagggccc-------agcagct-----------------ga--
A0A2K6GWM6_BCL2L2-      cccgggggagggccc-------agcagct-----------------ga--
                                                                          

A0A2K6EKG1_BCL2A1-      --------tccagagtgctgcaaaacattgcc------------------
A0A2K6GI15_MCL1-01      ggcttttggctgccgagaaggaggccacggcccggcgagaggtaggggga
A0A2K6F6N9_MCL1-01      agatctaggc----------------------------------------
A0A2K6GI15_MCL1-03      ggcttttggcaaccggcgccaaggacgca---------------------
A0A2K6F2Q2_BCL2L10      ---------ccgccgcgatgcgcttcgcagcc------------------
A0A2K6G3I7_BCL2-01      acccccctcccgctgcgcctcgggacccggcc------------------
A0A2K6G3C5_BCL2L1-      --------cccccagtgccattaatggcaacc------------------
A0A2K6G3C5_BCL2L1-      --------cccccagtgccattaatggcaacc------------------
A0A2K6GWM6_BCL2L2-      --------cccgctgcac---------caagc------------------
A0A2K6GWM6_BCL2L2-      --------cccgctgcac---------caagc------------------
                                 *                                        

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggggaagacggcacggtgattggcggaagccccggcgcaagccccccggc
A0A2K6F6N9_MCL1-01      ---------------------------------------------tgggc
A0A2K6GI15_MCL1-03      --------------------------------------aagccaatgggc
A0A2K6F2Q2_BCL2L10      -----------------------accaagatacggcggaagcacgcgtcc
A0A2K6G3I7_BCL2-01      -----------------------gccaggacctcgcccccgcccgccgcc
A0A2K6G3C5_BCL2L1-      -----------------------------------------catcct---
A0A2K6G3C5_BCL2L1-      -----------------------------------------catcctggc
A0A2K6GWM6_BCL2L2-      -----------------------------------------catgcgggc
A0A2K6GWM6_BCL2L2-      -----------------------------------------catgcgggc
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      ctccctcacgccagaagcccggagggtcgcgcggccggctcccattggtg
A0A2K6F6N9_MCL1-01      ctggctgggttt--------------------------------------
A0A2K6GI15_MCL1-03      aggtctggggccgccagcaggaaggcgctagagacc--------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      gccgcggggcctgcgcccagcccggtgccacctgtggtccacctgaccct
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      acctggcggacagccccccagcgaatggagccactggccacagcagcagt
A0A2K6GWM6_BCL2L2-      a-------------------------------------------------
A0A2K6GWM6_BCL2L2-      a-------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      ccgaagtccccgacgtcaccgcgacccc----------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      -------ttacgacgt----------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      ccgccag-------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ttggatgcccgggaggtgatccccatggcagcagtgaagcaagcactgaa
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      -----------------ttctccgtccaaaacgaagtcgaaaagaatctg
A0A2K6GI15_MCL1-01      ----ggagaggctgctgttcttcgcgcccacccgccgcgcattgccgtcc
A0A2K6F6N9_MCL1-01      ---------------------------------gaag------gccttcc
A0A2K6GI15_MCL1-03      ----gtcggggacggtgtgcagcgcaaccacgagacg------gccttcc
A0A2K6F2Q2_BCL2L10      -----------------ttcttctccgcctacgtcg--------------
A0A2K6G3I7_BCL2-01      ----gcgggcgatgacttctcccgccgctaccgccgc------gacttcg
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ggaggcgggcgatgaatttgaactgcggtaccggcgg------gcattca
A0A2K6GWM6_BCL2L2-      ----gctggagatgagtttgagacccgcttccggcgt------accttct
A0A2K6GWM6_BCL2L2-      ----gctggagatgagtttgagacccgcttccggcgt------accttct
                                                                          

A0A2K6EKG1_BCL2A1-      aaag-----------catgcttggacaa---------------------t
A0A2K6GI15_MCL1-01      gaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatga
A0A2K6F6N9_MCL1-01      aagg-----------catgcttcaga-----------------------a
A0A2K6GI15_MCL1-03      aagg-----------catgcttcgga-----------------------a
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      ccga-----------gatgtccagcc-----------------------a
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      gtga-----------cctgacatccc-----------------------a
A0A2K6GWM6_BCL2L2-      ctga-----------tctggcggctc-----------------------a
A0A2K6GWM6_BCL2L2-      ctga-----------tctggcggctc-----------------------a
                                                                          

A0A2K6EKG1_BCL2A1-      gttaatgtggcgtccatagatgcc---------------gccagaacgat
A0A2K6GI15_MCL1-01      gctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgc
A0A2K6F6N9_MCL1-01      actggac--atcaaaaacgaagac----------------gatgtcaaat
A0A2K6GI15_MCL1-03      actggac--atcaaaaacgaagac----------------gatgtcaaat
A0A2K6F2Q2_BCL2L10      ---------gctaccccgggaacc---------------gcgtctacctg
A0A2K6G3I7_BCL2-01      gctgcac--ctgacgcccttcacc---------------gcgaggggacg
A0A2K6G3C5_BCL2L1-      ------------------gggaca---------------gcatatcagag
A0A2K6G3C5_BCL2L1-      gctccac--atcaccctagggaca---------------gcatatcagag
A0A2K6GWM6_BCL2L2-      gctgcat--gtgacccccggctca---------------gcccagcagcg
A0A2K6GWM6_BCL2L2-      gctgcat--gtgacccccggctca---------------gcccagcagcg
                                                                          

A0A2K6EKG1_BCL2A1-      attca-atcaagtgatggaaaaggaatttgaagatggc------------
A0A2K6GI15_MCL1-01      ctttg-ctggagt--tggtcggggaggccagtaatggctccagcacggac
A0A2K6F6N9_MCL1-01      ctttatcacgagtgatggtccatgttttcagtgacagc------------
A0A2K6GI15_MCL1-03      ctttgtctcgagtgatggtccatgttttcagtgacggc------------
A0A2K6F2Q2_BCL2L10      ctg-g-agcggatggcggaggccgtgctctgcgacagc------------
A0A2K6G3I7_BCL2-01      ctttg-ccacggtggtggaggagctcttcagggatggg------------
A0A2K6G3C5_BCL2L1-      ctttg-aacaggtagtgaatgaactcttccgagatggg------------
A0A2K6G3C5_BCL2L1-      ctttg-aacaggtagtgaatgaactcttccgagatggg------------
A0A2K6GWM6_BCL2L2-      cttca-cccaggtctccgatgaacttttccaagggggc------------
A0A2K6GWM6_BCL2L2-      cttca-cccaggtctccgatgaacttttccaagggggc------------
                         *          *                       *             

A0A2K6EKG1_BCL2A1-      --atcgttaact--------------------ggggaaggattgtgaccg
A0A2K6GI15_MCL1-01      gggtcactaccctcgacgccgcccccagcagaggaggaggacgacgagtt
A0A2K6F6N9_MCL1-01      --gtaacaaact--------------------ggggcaggattgtgactt
A0A2K6GI15_MCL1-03      --gtaacaaact--------------------ggggcaggattgtgactc
A0A2K6F2Q2_BCL2L10      -----ctcagct--------------------ggggccgggtagtgatgc
A0A2K6G3I7_BCL2-01      -----gtgaact--------------------gggggaggattgtggcct
A0A2K6G3C5_BCL2L1-      -----gtaaact--------------------ggggtcgcattgtggcct
A0A2K6G3C5_BCL2L1-      -----gtaaact--------------------ggggtcgcattgtggcct
A0A2K6GWM6_BCL2L2-      -----cccaact--------------------ggggccgccttgtggcct
A0A2K6GWM6_BCL2L2-      -----cccaact--------------------ggggccgccttgtggcct
                                * *                     ** *  *      *    

A0A2K6EKG1_BCL2A1-      ---------------------------tgtttgcattcgga----ggtat
A0A2K6GI15_MCL1-01      gtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcaa
A0A2K6F6N9_MCL1-01      ------------------taatttctttttgtgcctttgtgtccaaacac
A0A2K6GI15_MCL1-03      ------------------taatttcttttggtgcctttgtggccaaacac
A0A2K6F2Q2_BCL2L10      ---------------------------tcgtgaccttcgcagg--gacgc
A0A2K6G3I7_BCL2-01      ---------------------------tctttgagttcggtgg--ggtca
A0A2K6G3C5_BCL2L1-      ---------------------------ttttctccttcggcgg--ggccc
A0A2K6G3C5_BCL2L1-      ---------------------------ttttctccttcggcgg--ggccc
A0A2K6GWM6_BCL2L2-      ---------------------------tcttcgtctttggggc--tgcac
A0A2K6GWM6_BCL2L2-      ---------------------------tcttcgtctttggggc--tgcac
                                                   *       ** *           

A0A2K6EKG1_BCL2A1-      tctcatcaagaaacttcta-c------------------gagagcagatt
A0A2K6GI15_MCL1-01      ccggcgccaaggacgcaaagc---------------caatgggcaggtct
A0A2K6F6N9_MCL1-01      ttg-----aagaccataaa-c---------------caagagagctgcat
A0A2K6GI15_MCL1-03      ttg-----aagagcataaa-c---------------caagaaagctgcat
A0A2K6F2Q2_BCL2L10      t-tctagagagagggccgc-cggtgaccgcctggtggaagaag------t
A0A2K6G3I7_BCL2-01      tgtgtgtggagagcgtcaa-c---------------cgggaga------t
A0A2K6G3C5_BCL2L1-      tctgcgtcgaaagcgtaga-c---------------aaggaga------t
A0A2K6G3C5_BCL2L1-      tctgcgtcgaaagcgtaga-c---------------aaggaga------t
A0A2K6GWM6_BCL2L2-      tgtgtgctgagagtgtcaa-c---------------aaggaga------t
A0A2K6GWM6_BCL2L2-      tgtgtgctgagagtgtcaa-c---------------aaggaga------t
                                            *                            *

A0A2K6EKG1_BCL2A1-      ---gccctggat-----------gtggatacttacaa---------gga-
A0A2K6GI15_MCL1-01      ggggccgccagc----------aggaaggcgctag-----------aga-
A0A2K6F6N9_MCL1-01      cgaaccattagc----------a-gaaagtatcac-----------aga-
A0A2K6GI15_MCL1-03      cgaaccattagc----------a-gaaagtatcac-----------aga-
A0A2K6F2Q2_BCL2L10      ggggcctccagccgcagccgaaggagggggatcccgaagtcgcccgggac
A0A2K6G3I7_BCL2-01      gtcgcccctggt-----------ggacaacatcgccctgt------gga-
A0A2K6G3C5_BCL2L1-      gcaggtattggt-----------gagtcggatcgcaactt------gga-
A0A2K6G3C5_BCL2L1-      gcaggtattggt-----------gagtcggatcgcaactt------gga-
A0A2K6GWM6_BCL2L2-      ggagccactggt-----------gggacaagtgcaggagt------gga-
A0A2K6GWM6_BCL2L2-      ggagccactggt-----------gggacaagtgcaggagt------gga-
                                                                       ** 

A0A2K6EKG1_BCL2A1-      -----------gatttcttattttattgctgagttca--taacgaataac
A0A2K6GI15_MCL1-01      ----------------ccttacgacgtgtcggggacggtgtgcagcgcaa
A0A2K6F6N9_MCL1-01      ----------------catt----cttgt-aaggacga------------
A0A2K6GI15_MCL1-03      ----------------cgtt----cttgt-aaggacaa------------
A0A2K6F2Q2_BCL2L10      cgccagcgcctggtggccct----gctgt-gcgcccggctggcggggcag
A0A2K6G3I7_BCL2-01      ----------tgactgagta----cctga-accggcacctgca-------
A0A2K6G3C5_BCL2L1-      ----------tggccactta----cctga-atgaccacctaga-------
A0A2K6G3C5_BCL2L1-      ----------tggccactta----cctga-atgaccacctaga-------
A0A2K6GWM6_BCL2L2-      ----------tggtggccta----cctgg-agacacggctggc-------
A0A2K6GWM6_BCL2L2-      ----------tggtggccta----cctgg-agacacggctggc-------
                                                  **       *              

A0A2K6EKG1_BCL2A1-      gcaggagagtggatacggcagaacggaggctgggaa-----------cac
A0A2K6GI15_MCL1-01      ccacgagacggcctt-------------ccaaggat------gggtttgt
A0A2K6F6N9_MCL1-01      -aacgagactggcta-----------------------------------
A0A2K6GI15_MCL1-03      -aacgagactggctagtcaaacaaagaggctgggat------gggtttgt
A0A2K6F2Q2_BCL2L10      caccgcgcctggctgcaggctcaaggcggctgggat-----ggcttttgt
A0A2K6G3I7_BCL2-01      -----cacctggatccaggataacggaggctgggac------gcctttgt
A0A2K6G3C5_BCL2L1-      -----gccttggatccaggagaacggcggctgggac------acttttgt
A0A2K6G3C5_BCL2L1-      -----gccttggatccaggagaacggcggctgggac------acttttgt
A0A2K6GWM6_BCL2L2-      -----cgactggatccacagcagtgggggctgggagctggaagccatcaa
A0A2K6GWM6_BCL2L2-      -----cgactggatccacagcagtgggggctgggcg------gagttcac
                                  *  *                                    

A0A2K6EKG1_BCL2A1-      ggcttcgtaaagaagtttgaacctagacctgcctggctgact--------
A0A2K6GI15_MCL1-01      ggagttcttccatgtagaggacctagaaggcggcatcagaaa--------
A0A2K6F6N9_MCL1-01      ----ttcttccatgtagaagacctggaaggcagcatcagaaa--------
A0A2K6GI15_MCL1-03      ggagttcttccatgtagaggacctagaaggcggcatcagaaa--------
A0A2K6F2Q2_BCL2L10      gacttattcaggaaacccttgccgctagctgtttggaggaga--------
A0A2K6G3I7_BCL2-01      ggaattgtatggtccc----------agc-------atgcgg--------
A0A2K6G3C5_BCL2L1-      ggaactctacggaaac----------aatgcagcagctgaga--------
A0A2K6G3C5_BCL2L1-      ggaactctacggaaac----------aatgcagcagctgaga--------
A0A2K6GWM6_BCL2L2-      agctc------gggtc----------agggagatggaggaagaagctgag
A0A2K6GWM6_BCL2L2-      agctctatacggggac----------ggggccctggaggagg--------
                                                              *           

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      aagttaaaagagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K6GWM6_BCL2L2-      --------------------cgcgg-------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      ----------------------------tgtgctgctgg-----------
A0A2K6F6N9_MCL1-01      ----------------------------tgtgctgctgg-----------
A0A2K6GI15_MCL1-03      ----------------------------tgtgctgctgg-----------
A0A2K6F2Q2_BCL2L10      --------------------------------ctgctggt----------
A0A2K6G3I7_BCL2-01      -----------------------------cctctgtttga----------
A0A2K6G3C5_BCL2L1-      ----------------------------------gccggaagggccagga
A0A2K6G3C5_BCL2L1-      ----------------------------------gccggaagggccagga
A0A2K6GWM6_BCL2L2-      acctccaggcaatgctggtccagtgatcatgtccattgaagagaaaatgg
A0A2K6GWM6_BCL2L2-      -----------------------------cgtctgcgggaggggaactgg
                                                                          

A0A2K6EKG1_BCL2A1-      ----------------tttctg----------------------gaagtt
A0A2K6GI15_MCL1-01      ----------------cttttg----------------------------
A0A2K6F6N9_MCL1-01      ----------------cttttg----------------------------
A0A2K6GI15_MCL1-03      ----------------cttttg----------------------------
A0A2K6F2Q2_BCL2L10      ---------ccaggttcttttg-tcatgctttttagcaacgaccgtcatc
A0A2K6G3I7_BCL2-01      -------------tttctcctg------gctgtctctgaagactctgc--
A0A2K6G3C5_BCL2L1-      a----------cgcttcaaccgctggttcctgacgggcatgactgtgg--
A0A2K6G3C5_BCL2L1-      a----------cgcttcaaccgctggttcctgacgggcatgactgtgg--
A0A2K6GWM6_BCL2L2-      aggctgatgcccgttccatcta-----tgttggcaatgtggactatggtg
A0A2K6GWM6_BCL2L2-      g---------------catcag-----tgaggacagtgctga--------
                                                                          

A0A2K6EKG1_BCL2A1-      acggggaagatctgtgacatgctg--------------------------
A0A2K6GI15_MCL1-01      caggtgttgctggagtaggagctg--------------------------
A0A2K6F6N9_MCL1-01      ctggtgttgctggagtaggagctg--------------------------
A0A2K6GI15_MCL1-03      caggtgttgctggagtaggagctg--------------------------
A0A2K6F2Q2_BCL2L10      ta---------tttctggacacga--------------------------
A0A2K6G3I7_BCL2-01      tcagcctggccctggtgggagctt--------------------------
A0A2K6G3C5_BCL2L1-      ctggcgtggttctgctgggctcgc--------------------------
A0A2K6G3C5_BCL2L1-      ctggcgtggttctgctgggctcgc--------------------------
A0A2K6GWM6_BCL2L2-      caacagcagaagagctggaagctcactttcatggttgtggttcagtcaac
A0A2K6GWM6_BCL2L2-      caggggccgtggcactgggggccc--------------------------
                                             *                            

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      -----------------gcatcaccctgggtgcc----------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      cgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgc
A0A2K6GWM6_BCL2L2-      -----------------tggtaactgtaggggcc----------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      atatatagagttctcagacaaagagtcagtgaggacttccctggccttag
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      atgagtccctgtttagaggaagacaaatcaaggtaagcctgtgctttcca
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      -------tccctcctctactcctga-------------------------
A0A2K6GI15_MCL1-01      -------gtttggcatatctaataagatagccttgtaa------------
A0A2K6F6N9_MCL1-01      -------gtttgacttatctaataagatag--------------------
A0A2K6GI15_MCL1-03      -------gtttggcatatctaataagatag--------------------
A0A2K6F2Q2_BCL2L10      -------ttatt---------atga-------------------------
A0A2K6G3I7_BCL2-01      -------tatctgggccacaagtga-------------------------
A0A2K6G3C5_BCL2L1-      --------tcttcagtcggaaatga-------------------------
A0A2K6G3C5_BCL2L1-      --------tcttcagtcggaaatga-------------------------
A0A2K6GWM6_BCL2L2-      ttgtacatcctttactctcaggtgatcccaaaacgaaccaacagaccagg
A0A2K6GWM6_BCL2L2-      -------tttttcgctagcaagtga-------------------------
                                              * *                         

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      catcagcacaacagaccggggtttcccacgagcccgctaccgtgcccgga
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      ctaccaactacaacagttcccgctctcgattctacagtggttttaacagc
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      aggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6EKG1_BCL2A1-      -------------
A0A2K6GI15_MCL1-01      -------------
A0A2K6F6N9_MCL1-01      -------------
A0A2K6GI15_MCL1-03      -------------
A0A2K6F2Q2_BCL2L10      -------------
A0A2K6G3I7_BCL2-01      -------------
A0A2K6G3C5_BCL2L1-      -------------
A0A2K6G3C5_BCL2L1-      -------------
A0A2K6GWM6_BCL2L2-      ttccccttactaa
A0A2K6GWM6_BCL2L2-      -------------
                                     

© 1998-2020Legal notice