Dataset for CDS BCL2L2 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7G4L5_BCL2L2-03      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
F7G4L5_BCL2L2-01      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
F7G4L5_BCL2L2-02      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
                      ****** *  * **  ****  ***   ** ****  ***  *** * * 

F7G4L5_BCL2L2-03      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
F7G4L5_BCL2L2-01      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
F7G4L5_BCL2L2-02      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
                           ** *    ** * *** *  * *  *   ***    ** ** ** 

F7G4L5_BCL2L2-03      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
F7G4L5_BCL2L2-01      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
F7G4L5_BCL2L2-02      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
                          ***  ****  * **  * ***     *  ***     * * * * 

F7G4L5_BCL2L2-03      acggcctg----gagtctgaggaactggagcctgaggagctgct----gc
F7G4L5_BCL2L2-01      gcagctggagatgagttcga-gacccgcttccggcgcaccttctctgatc
F7G4L5_BCL2L2-02      gcagctggagatgagttcga-gacccgcttccggcgcaccttctctgatc
                       * **  *    ****  ** ** * *   ** * * * ** **     *

F7G4L5_BCL2L2-03      tggagcccgagccg-----gagcccgagccc-gaagaggagc----cgcc
F7G4L5_BCL2L2-01      tggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
F7G4L5_BCL2L2-02      tggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
                      *** * *  *** *     ** ***  ** * * * ** * *    * **

F7G4L5_BCL2L2-03      ccggcccc------gcgcccccccgggagctccgg--------gccctg-
F7G4L5_BCL2L2-01      caggtctccgatgaacttttccaagggggccccaactggggccgccttgt
F7G4L5_BCL2L2-02      caggtctccgatgaacttttccaagggggccccaactggggccgccttgt
                      * ** * *       *    **  *** ** **          *** ** 

F7G4L5_BCL2L2-03      ggcctggttcg-----ggagc--ccccggcagccaagag-------gagg
F7G4L5_BCL2L2-01      agccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaagg
F7G4L5_BCL2L2-02      agccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaagg
                       ****  ** *     ** **  * * *   **  ****        ***

F7G4L5_BCL2L2-03      aggaggagcc------gggac--------tggtcgagggtgac---ccgg
F7G4L5_BCL2L2-01      agatggaaccactggtgggacaagtgcaggagtggatggtggcctacctg
F7G4L5_BCL2L2-02      agatggaaccactggtgggacaagtgcaggagtggatggtggcctacctg
                      **  *** **      *****          ** ** **** *   ** *

F7G4L5_BCL2L2-03      gggacggcgc-------------------cattgaggacccggagctgga
F7G4L5_BCL2L2-01      gagacgcggctggctgactggatccacagcagtgggggctgggcg-----
F7G4L5_BCL2L2-02      gagacgcggctggctgactggatccacagcagtgggggctgggagctgga
                      * ****  **                   ** ** ** *  ** *     

F7G4L5_BCL2L2-03      agctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaa
F7G4L5_BCL2L2-01      -gagttcacagctctatacgggg---------------------------
F7G4L5_BCL2L2-02      agctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaa
                       *   *** ***** *  * ***                           

F7G4L5_BCL2L2-03      aggagctacagaacgaggtagagaagcagatgaatatgagtccacctcca
F7G4L5_BCL2L2-01      ------------acgggg--------------------------------
F7G4L5_BCL2L2-02      aggagctacagaacgaggtagagaagcagatgaatatgagtccacctcca
                                  *** **                                

F7G4L5_BCL2L2-03      ggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctga
F7G4L5_BCL2L2-01      -------------------------ccctggaggaggcg-cggcgtctg-
F7G4L5_BCL2L2-02      ggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctga
                                               ** * ******  *  ** * *** 

F7G4L5_BCL2L2-03      tgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
F7G4L5_BCL2L2-01      -----------------------------------------cgggagggg
F7G4L5_BCL2L2-02      tgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
                                                               * * **  *

F7G4L5_BCL2L2-03      agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccata
F7G4L5_BCL2L2-01      aactgg--------------------------------------------
F7G4L5_BCL2L2-02      agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccata
                      * ****                                            

F7G4L5_BCL2L2-03      ctctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagtt
F7G4L5_BCL2L2-01      --------------------------------------------------
F7G4L5_BCL2L2-02      ctctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagtt

F7G4L5_BCL2L2-03      ctcagacaaagagtcagtgaggacttccttggccttagatgagtccctat
F7G4L5_BCL2L2-01      ----------gcatcagtgaggac--------------------------
F7G4L5_BCL2L2-02      ctcagacaaagagtcagtgaggacttccttggccttagatgagtccctat
                                *  ***********                          

F7G4L5_BCL2L2-03      ttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggc
F7G4L5_BCL2L2-01      -------------------agtg---------------------------
F7G4L5_BCL2L2-02      ttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggc

F7G4L5_BCL2L2-03      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
F7G4L5_BCL2L2-01      ----------ctgacggggg------------------------------
F7G4L5_BCL2L2-02      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
                                * *** ****                              

F7G4L5_BCL2L2-03      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
F7G4L5_BCL2L2-01      ---------------------------------ccgtggc----actggg
F7G4L5_BCL2L2-02      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
                                                       * ****     ** *  

F7G4L5_BCL2L2-03      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
F7G4L5_BCL2L2-01      ggccctg-----gtaactgtaggggcc--------------------ttt
F7G4L5_BCL2L2-02      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
                      ***** *     **  **  *******                    * *

F7G4L5_BCL2L2-03      tccccttac---taa
F7G4L5_BCL2L2-01      tttgctagcaagtga
F7G4L5_BCL2L2-02      tccccttac---taa
                      *   **  *   * *

© 1998-2023Legal notice