Dataset for CDS BCL-2-like of organism Salvator merianae

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8D0BPX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salvator merianae GN=BCL-2 (length=690 residues).
atggctcatcccgggataagaggttacgataacagggagatagtgctaaggtacatccattacaagctgtcacaaaaagg
atatgattgggttgccagcggagatggagaaaacgtttctgatactgctgctgctgcttctgctgctactgagaccttcc
atacccttactggtctggtgtctctgccttctgagctgcctggctctgtcgctccagtcgacgagtggcgccctgtgcca
cangtggtccactcaactttacgtcaagctggtgatgagttttctcgacgttaccggagagactttgctcagatgtctgg
gcagctgcacttgaccccacgcactgccagagctcgttttacggcagttgtggaagagctgttccgagatgggataaact
ggggcaggattgtggcattctttgaatttggtggcatgatgtgtgtggagagcgtcagtcgggagatgacgccccttgtg
gacagtgttactatgtggatgactgagtacctgaataggcatctgcacaactggatccaggacaatggaggctgggatgc
ttttgtggagctttacagcaacaacatgaggcctttgtttgatttctcatggctgccgctgaagacaatcctgagtctgg
ctttggtgggcgcgtgcatcacccttggtgcttaccttgggcataagtga
>gnl|bcl2dbcds|A0A8D0E1K1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salvator merianae GN=BCL2L1 (length=675 residues).
atgtcgagcgggaaccgcgcgctcgtcatagactttatctcctacaagctctcccagaggggccacaactggagcgacct
ggaggggaacggcgaggacaggactgagctggccgaggggatgagcggcgtccccaacgggagcccctcgtgggcctccg
gcagcagcccggtgacgaacggggcgaccgggcacccgagcatccttgaagacaacgccaggtgggacgtgaggcagacg
ctcagggaggcgggcgatgagtttgaactgaggtaccggcgggctttcagcgacctgacgtcccagctgcacatcacccc
cggcaccgcttaccagagctttgagcaggtggtgaacgaactctttcgggacggggtgaactgggggcggattgtggcgt
ttttctccttcggaggagccctgtgcgtggagagcgtcgacaaggagatgcacgtgctggtgagtcggatcgccgtctgg
atgaccacttacctgactgaccatctggagccgtggatccaagataatgggggctgggaccggtttgtggatctctatgg
gaatgacgccgctgccaagagccggaagggccaagaacgcttcaacaagtggctgttgacgggggccaccgtggccgggg
tcctgctcctcggctccctgctgagccgcaaatag
>gnl|bcl2dbcds|A0A8D0E7Q9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salvator merianae GN=MCL-1 (length=1104 residues).
atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctcgggcctggccccggcggcccctgtctcccc
cggcgcgggcggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcgccgcgcatcg
gcggcttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctggacggcttcgagccggagga
cgaggcgcccgcgggcggcgggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctgcgccgggtgacgctggagctggtgcggcgc
tacctgcacgaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggcaagaagctctt
tcagggcctcatgggccggttcgggaccccctcggcgggcgccccttccgccttggcttcctcctcgtcgtcgccctgcg
tggcccaggcgctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagctggccttccaaggaatgctt
aagaagctggaaatcaagaatgaagaagacctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaagaccataaacaaagagaacg
gcatcagtacgttggcagacatcatcacagacgtgctggtgacagataagcgagaatggctgctgaaccacaatgcctgg
gaagggttcattaaattcttccacgtagaagacatagagggcagcatccgaaatgttctggtagcttttgcgggcgtggc
aggtgtaggagcaggtttggcgtacctgatccggccaccagaattgtctctgagtcagatgtaa
>gnl|bcl2dbcds|A0A8D0E7Q9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salvator merianae GN=MCL-1 (length=1077 residues).
atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctcgggcctggccccggcggcccctgtctcccc
cggcgcgggcggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcgccgcgcatcg
gcggcttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctggacggcttcgagccggagga
cgaggcgcccgcgggcggcgggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctgcgccgggtgacgctggagctggtgcggcgc
tacctgcacgaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggcaagaagctctt
tcagggcctcatgggccggttcgggaccccctcggcgggcgccccttccgccttggcttcctcctcgtcgtcgccctgcg
tggcccaggcgctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagctggccttccaaggaatgctt
aagaagctggaaatcaagaatgaagaagacctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaagaccataaacaaagagaacg
gcatcagtacgttggcagacatcatcacagacgtgctggtgacagataagcgagaatggctgctgaaccacaatgcctgg
gaagggttcattaaattcttccacgtagaagacatagagggcagcatccgaaatgttctggtagcttttgcgggcgtggc
aggtgtaggagcaggtttggcgtacctgatccggtga
>gnl|bcl2dbcds|A0A8D0EB90_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Salvator merianae GN=BCL2A1 (length=483 residues).
atggaaagctgtgagcacctttatgtttacagtctggttgaagattacttgaaatatgtttctcaggaaacaatgtttga
agctcctccaagcagagctgctgaagtcttgcgcaaaattgcgccttcacttcaagaagaagttgagaagaaattggaac
tgttgtgggactcagttgagatcacttctgttgacaaagccagtaaaatattcaacaaagtgatggaagaggaattttct
gatggaaacaccaactgggggcgaattgtgacaatattcctgtttggaggaattcttgccaaaaaactacaaaaacaagg
agtcgttttgacaaaagaaaatacaagagagatttctcacttcattgcagactatatcattaatactaaagcaaagtgga
tccatgaaaatggaggatgggtaagtaattcttatgctcaaattttatttaacaccatcatatcccttgtaagaaaatat
tag
© 1998-2023Legal notice