Dataset for CDS BCL-2-like of organism Salvator merianae

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D0EB90_BCL2A1-      atg----------------gaa----------------------------
A0A8D0BPX3_BCL2-01      atggctcatcccgggataagaggttacgataacagggagatagtgctaag
A0A8D0E1K1_BCL2L1-      atg--tc-------gagcggga--------accg-------cgcgct---
A0A8D0E7Q9_MCL1-01      atg--ccattgttgaatcggaa--------agcgatggtgctgtgctgtg
A0A8D0E7Q9_MCL1-02      atg--ccattgttgaatcggaa--------agcgatggtgctgtgctgtg
                        ***                *                              

A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A8D0BPX3_BCL2-01      gta----------------------------catccattaca--------
A0A8D0E1K1_BCL2L1-      ----cgtcatagactt---------------tatctcctaca--------
A0A8D0E7Q9_MCL1-01      ggagcgcctcgggcctggccccggcggcccctgtctcccccggcgcgggc
A0A8D0E7Q9_MCL1-02      ggagcgcctcgggcctggccccggcggcccctgtctcccccggcgcgggc
                                                                          

A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      ggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgcc
A0A8D0E7Q9_MCL1-02      ggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgcc
                                                                          

A0A8D0EB90_BCL2A1-      ----------------------agctgt----------------------
A0A8D0BPX3_BCL2-01      ----------------------agctgtca--------------------
A0A8D0E1K1_BCL2L1-      ----------------------agctctcc--------------------
A0A8D0E7Q9_MCL1-01      gttctcggcgccgcgcatcggcggcttcccctggccgcgcccgggcctgg
A0A8D0E7Q9_MCL1-02      gttctcggcgccgcgcatcggcggcttcccctggccgcgcccgggcctgg
                                               ***                        

A0A8D0EB90_BCL2A1-      ------gagcacctttatgttt---------acagtctgg----------
A0A8D0BPX3_BCL2-01      caaaaaggatatgattgggttg---------ccagcggag----------
A0A8D0E1K1_BCL2L1-      cagaggggccacaactggagcga--------cctggaggg----------
A0A8D0E7Q9_MCL1-01      cggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
A0A8D0E7Q9_MCL1-02      cggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
                              *        *                * *    *          

A0A8D0EB90_BCL2A1-      -------------------------------------------ttgaaga
A0A8D0BPX3_BCL2-01      -------------------------------------------atggaga
A0A8D0E1K1_BCL2L1-      ----gaacggc--------------------------------gaggaca
A0A8D0E7Q9_MCL1-01      ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggaga
A0A8D0E7Q9_MCL1-02      ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggaga
                                                                     * * *

A0A8D0EB90_BCL2A1-      ttac----ttgaaa------------------------------------
A0A8D0BPX3_BCL2-01      aaacgtttctgata------------------------------------
A0A8D0E1K1_BCL2L1-      ggactgagctggccg----------aggggatgag---------------
A0A8D0E7Q9_MCL1-01      agaa-gagctggacggcttcgagccggaggacgaggcgcccgcgggcggc
A0A8D0E7Q9_MCL1-02      agaa-gagctggacggcttcgagccggaggacgaggcgcccgcgggcggc
                          *      **                                       

A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A8D0BPX3_BCL2-01      ----ctgctgctgctgcttctgctgctactgag-----------------
A0A8D0E1K1_BCL2L1-      ----cggcgtccccaacg-----------ggag-----------------
A0A8D0E7Q9_MCL1-01      gggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactc
A0A8D0E7Q9_MCL1-02      gggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactc
                                                                          

A0A8D0EB90_BCL2A1-      --------------------tatgtttctcaggaaacaat----------
A0A8D0BPX3_BCL2-01      -------------------------accttccatacccttactg------
A0A8D0E1K1_BCL2L1-      ------------cccctcg---tgggcctccggcagca------------
A0A8D0E7Q9_MCL1-01      ggccgcctcctcctcctcgtcctcgtcctccgccgccgccgccgaccgcc
A0A8D0E7Q9_MCL1-02      ggccgcctcctcctcctcgtcctcgtcctccgccgccgccgccgaccgcc
                                                   **       *             

A0A8D0EB90_BCL2A1-      ------------gtttgaagctcctc------------------------
A0A8D0BPX3_BCL2-01      ------------gtctggtgtctctg------------------------
A0A8D0E1K1_BCL2L1-      ------------gcccggtga-----------------------------
A0A8D0E7Q9_MCL1-01      acgacgacctgcgccgggtgacgctggagctggtgcggcgctacctgcac
A0A8D0E7Q9_MCL1-02      acgacgacctgcgccgggtgacgctggagctggtgcggcgctacctgcac
                                    *   *  *                              

A0A8D0EB90_BCL2A1-      --------caagcagagctgc-----------------------------
A0A8D0BPX3_BCL2-01      --------ccttctgagctgc-----------------------------
A0A8D0E1K1_BCL2L1-      --------cgaacggggcgac-----------------------------
A0A8D0E7Q9_MCL1-01      gaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggc
A0A8D0E7Q9_MCL1-02      gaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggc
                                *   * * **  *                             

A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      gggcggcggcaagaagctctttcagggcctcatgggccggttcgggaccc
A0A8D0E7Q9_MCL1-02      gggcggcggcaagaagctctttcagggcctcatgggccggttcgggaccc
                                                                          

A0A8D0EB90_BCL2A1-      ------------------------tgaagtctt--gcgcaaaattgcgcc
A0A8D0BPX3_BCL2-01      ------ctggctc-----------tgtcgctccagtcgacgagtggcgcc
A0A8D0E1K1_BCL2L1-      ------cgggcaccc---------gagcatccttgaagacaa----cgcc
A0A8D0E7Q9_MCL1-01      cctcggcgggcgccccttccgccttggcttcctcctcgtcgt----cgcc
A0A8D0E7Q9_MCL1-02      cctcggcgggcgccccttccgccttggcttcctcctcgtcgt----cgcc
                                                             *        ****

A0A8D0EB90_BCL2A1-      tt----------------------cacttcaagaagaagttgagaagaaa
A0A8D0BPX3_BCL2-01      ctgtgccac--angtggtccactcaactttacgtcaagctggtgatg--a
A0A8D0E1K1_BCL2L1-      aggtgggac----gtgaggca---gacgctcagggaggcgggcgatg--a
A0A8D0E7Q9_MCL1-01      ctgcgtggcccaggcgctgga---gaccctccgcagggtgggcgacgcca
A0A8D0E7Q9_MCL1-02      ctgcgtggcccaggcgctgga---gaccctccgcagggtgggcgacgcca
                                                 **     *        * ** *  *

A0A8D0EB90_BCL2A1-      tt---------ggaactgttgtgggactcagttgagatcactt-------
A0A8D0BPX3_BCL2-01      gttttctcgacgttaccg--gagagactttgctcagatgtctgggcagct
A0A8D0E1K1_BCL2L1-      gtttgaactgaggtaccg--gcgggctttcagcgacctgacgtcccagct
A0A8D0E7Q9_MCL1-01      ttctcgac--aagcacca--gctggccttccaaggaatgcttaagaagct
A0A8D0E7Q9_MCL1-02      ttctcgac--aagcacca--gctggccttccaaggaatgcttaagaagct
                         *            **    *   *  *         *            

A0A8D0EB90_BCL2A1-      --------------------ctgttgacaaag----ccagtaaaatattc
A0A8D0BPX3_BCL2-01      gcacttga------------ccccacgcactg----ccagagctcgtttt
A0A8D0E1K1_BCL2L1-      gcacatca------------cccccggcaccgcttaccagagc----ttt
A0A8D0E7Q9_MCL1-01      ggaaatcaagaatgaagaagacctcaagactg--tatcagaag----tt-
A0A8D0E7Q9_MCL1-02      ggaaatcaagaatgaagaagacctcaagactg--tatcagaag----tt-
                                                    *  *     ***       ** 

A0A8D0EB90_BCL2A1-      aacaaagtgatggaagaggaattttctgatggaaacaccaactgggggcg
A0A8D0BPX3_BCL2-01      acggcagttgtggaagagctgttccgagatgggata---aactggggcag
A0A8D0E1K1_BCL2L1-      gagcaggtggtgaacgaactctttcgggacggggtg---aactgggggcg
A0A8D0E7Q9_MCL1-01      --gcaactcatg-------ttttcagtgacggagtgacaaactggggccg
A0A8D0E7Q9_MCL1-02      --gcaactcatg-------ttttcagtgacggagtgacaaactggggccg
                               *  **         **    ** **       ********  *

A0A8D0EB90_BCL2A1-      aattgtgacaatattcctgtttggaggaattcttgccaaaaaactacaaa
A0A8D0BPX3_BCL2-01      gattgtggcattctttgaatttggtggcatgat------gtgtgtggaga
A0A8D0E1K1_BCL2L1-      gattgtggcgtttttctccttcggaggagccct------gtgcgtggaga
A0A8D0E7Q9_MCL1-01      gattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaaga
A0A8D0E7Q9_MCL1-02      gattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaaga
                         ****** *  *  *    ** ** *      *           *  * *

A0A8D0EB90_BCL2A1-      -----aacaaggag----tcgt------tttgacaaaagaaaatacaaga
A0A8D0BPX3_BCL2-01      gcgtcagtcgggagat-gacgc-----cccttgtggacagtgttactatg
A0A8D0E1K1_BCL2L1-      gcgtcgacaaggagatgcacgt------gctggtgagtcggatcgccgtc
A0A8D0E7Q9_MCL1-01      ccataaacaaagagaacggcatcagtacgttggcagacatcatcacagac
A0A8D0E7Q9_MCL1-02      ccataaacaaagagaacggcatcagtacgttggcagacatcatcacagac
                                   ***     *          *              *    

A0A8D0EB90_BCL2A1-      gagatttctcacttcattgcagactatatcattaatactaaagcaaa-gt
A0A8D0BPX3_BCL2-01      tggatgactgagtacctgaataggcat----------ctgca-caactg-
A0A8D0E1K1_BCL2L1-      tggatgaccacttacctgactgaccat----------ctgga---gccgt
A0A8D0E7Q9_MCL1-01      gtgctgg---------tgacagataag----------cgagaatggctgc
A0A8D0E7Q9_MCL1-02      gtgctgg---------tgacagataag----------cgagaatggctgc
                          * *           *        *           *   *      * 

A0A8D0EB90_BCL2A1-      ggatccatgaaaatggaggatggg-------taagtaattct--------
A0A8D0BPX3_BCL2-01      -gatccaggacaatggaggctgggatgcttttgtggagcttt---acagc
A0A8D0E1K1_BCL2L1-      ggatccaagataatgggggctgggaccggtttgtggatctct---atggg
A0A8D0E7Q9_MCL1-01      tgaaccacaat------gcctgggaagggttcattaaattcttccacgta
A0A8D0E7Q9_MCL1-02      tgaaccacaat------gcctgggaagggttcattaaattcttccacgta
                         ** ***  *       *  ****            *  * *        

A0A8D0EB90_BCL2A1-      ------------------------tatgctcaaattttatttaac-----
A0A8D0BPX3_BCL2-01      aacaacat----------------gaggcctttgtttgatttctc----a
A0A8D0E1K1_BCL2L1-      aatgacgccgctgccaagagccggaagggccaagaacgcttcaacaa--g
A0A8D0E7Q9_MCL1-01      gaagacatagagggcagcatccgaaatgttctggta-gcttttgcgggcg
A0A8D0E7Q9_MCL1-02      gaagacatagagggcagcatccgaaatgttctggta-gcttttgcgggcg
                                                 * *           **   *     

A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A8D0BPX3_BCL2-01      tggctgccgctgaagacaatcctgagtctggctttggtgggcgcgtgcat
A0A8D0E1K1_BCL2L1-      tggctgttgacgggggcc------------accgtggc---cggggtcct
A0A8D0E7Q9_MCL1-01      tggcaggtg-taggagca------------ggtttggcgtacctgatccg
A0A8D0E7Q9_MCL1-02      tggcaggtg-taggagca------------ggtttggcgtacctgatccg
                                                                          

A0A8D0EB90_BCL2A1-      -accatcatatcccttgtaagaaaatattag
A0A8D0BPX3_BCL2-01      cacccttggtgcttaccttgggcataagtga
A0A8D0E1K1_BCL2L1-      gctcctcggctccctgctgagccgcaaatag
A0A8D0E7Q9_MCL1-01      gccaccagaattgtctctgagtcagatgtaa
A0A8D0E7Q9_MCL1-02      ---------------------------gtga
                                                    *  

© 1998-2023Legal notice