Dataset for CDS Unclassified of organism Scophthalmus maximus

[Download (right click)]

11 sequence(s)

>gnl|bcl2dbcds|A0A2U9B3E4_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=378 residues).
atgattgtcgcgttggagcgcacgaagggccccgggaccgtaacccaggaggccaaggcggtctttgtcgatggtgttgt
caactggggccgcattgtcagcctggtgagcttaggggccgcgatctgccagagccgcggtttcgaatgccgcggatcgg
gcgaaaacgcaacggagactgtggaagaagagatagcttcgtatttgctcaaagaacacgaagactggctggtggcaaac
gactattcggatggattcgtggccttctttaagacaccagggacctcagacagggaggatctcggacaattgcctctccg
acccatacttgccattggagctgtgcttttgacatgtaccctgttccgtttcaagtga
>gnl|bcl2dbcds|A0A2U9BDX9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=1401 residues).
atgtgtgaccagacgttcgtggcggtcacctttggcccctgcgacaactgcacgaaggccagtcccctgatgaacatcta
catcaagactgaggccatcaactactgctccctctgcgtggaactgatggcctgtcaggggctccagaagggggaaaccc
tggcgtctctgaagacggagagcgacggtctgaagaagaagctggaggtggagcggggcaagctgaacgacgtggagttg
caccaggtggcagagaagaccgaggtgttgggcgctctctccataaagaccagacgagtcctgaagggccacggggccaa
ggtgctgtgtatggactggtgcaaagacaaacgtcgtctcgtcagctcttcacaggacggaaaggtgattgtgtgggatg
cattcactctcaacaaggaacatggggtgtccctgccatgtacatgggtaatggcgtgtgcttatgctccctcaggttgc
gctgtggcgtgtggtggactggataacaagtgctccgtgatcccgctgtcgctggacaaagatgagaacttggccgcgaa
gaagaagtcggtcgccatgcacaccaactatgtgtcaggctgcaccttcaccaactctgacatgcagatgctgacctcca
gtggtgacggcacatgtgccctgtgggacgtggagagcgggcagctcctgcagagtttccacggtcacacagctgatgtc
ttgtccctggacctcgccccgtctgaaactggaaacacctttgtctccgggggctgtgataggaaggccaacgtgtggga
catgcgctctggtcagaacatccagtcttttgagagccatgagtccgacatcaactgtgtgaagtactaccccagcggag
acgcattcgcttctgcttctgacgatgccacatgccgtttctatgatctacgagctgaccgcgaagtagccgtctaccag
aaggacagcatcgtgtttggtgcttccactgtggacttctctctgagtggtcgcctactcttcgctggttacaatgacta
caccatcaatgcgtgggacgtgctgaagggaaatcgtgtctccatcctgtttggccatgagaaccgcgtcagcagagtca
aattgtcacctgacggcacggccatctgctcggcctcatgggacaacaccttgcgggagctggcacaggggcccgggagc
tgcaggggactggcagagaccatagccgattacctgggagaggagaagaaggactggctgctggagaacgatggatggga
tgggttctgtaagttctcccgcagtgccagagagatgagccaggactcgtcgatgaagacggctctgtttgctgctgctg
gcgtggggcttgccggactcaccttcctgctggtgcgctag
>gnl|bcl2dbcds|A0A2U9BDX9_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=1188 residues).
atgtgtgaccagacgttcgtggcggtcacctttggcccctgcgacaactgcacgaaggccagtcccctgatgaacatcta
catcaagactgaggccatcaactactgctccctctgcgtggaactgatggcctgtcaggggctccagaagggggaaaccc
tggcgtctctgaagacggagagcgacggtctgaagaagaagctggaggtggagcggggcaagctgaacgacgtggagttg
caccaggtggcagagaagaccgaggtgttgggcgctctctccataaagaccagacgagtcctgaagggccacggggccaa
ggtgctgtgtatggactggtgcaaagacaaacgtcgtctcgtcagctcttcacaggacggaaaggtgattgtgtgggatg
cattcactctcaacaaggaacatggggtgtccctgccatgtacatgggtaatggcgtgtgcttatgctccctcaggttgc
gctgtggcgtgtggtggactggataacaagtgctccgtgatcccgctgtcgctggacaaagatgagaacttggccgcgaa
gaagaagtcggtcgccatgcacaccaactatgtgtcaggctgcaccttcaccaactctgacatgcagatgctgacctcca
gtggtgacggcacatgtgccctgtgggacgtggagagcgggcagctcctgcagagtttccacggtcacacagctgatgtc
ttgtccctggacctcgccccgtctgaaactggaaacacctttgtctccgggggctgtgataggaaggccaacgtgtggga
catgcgctctggtcagaacatccagtcttttgagagccatgagtccgacatcaactgtgtgaagtactaccccagcggag
acgcattcgcttctgcttctgacgatgccacatgccgtttctatgatctacgagctgaccgcgaagtagccgtctaccag
aaggacagcatcgtgtttggtgcttccactgtggacttctctctgagtggtcgcctactcttcgctggttacaatgacta
caccatcaatgcgtgggacgtgctgaagggaaatcgtgtctccatcctgtttggccatgagaaccgcgtcagcagagtca
aattgtcacctgacggcacggccatctgctcggcctcatgggacaacaccttgcggatttgggcgtag
>gnl|bcl2dbcds|A0A8D3AUX5_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=423 residues).
atgcacttgtcaccctttcctcccctccctactatgtttgcagacatgattgtcgcgttggagcgcacgaagggccccgg
gaccgtaacccaggaggccaaggcggtctttgtcgatggtgttgtcaactggggccgcattgtcagcctggtgagcttag
gggccgcgatctgccagagccgcggtttcgaatgccgcggatcgggcgaaaacgcaacggagactgtggaagaagagata
gcttcgtatttgctcaaagaacacgaagactggctggtggcaaacgactattcggatggattcgtggccttctttaagac
accagggacctcagacagggaggatctcggacaattgcctctccgacccatacttgccattggagctgtgcttttgacat
gtaccctgttccgtttcaagtga
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=933 residues).
ctccacctccttttccggggccgccgcccgccccgttgcgacgtgaccggaggctcaagtgggattgggaaatccattgc
agtggagtgctacagacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagagg
tggagaaatttgccatcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaa
agtgtgataaaacaggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaa
gtttgaggaagtggaggtggaccgtttcaaaaaactgatggaagtgaactacctgggcagcgtttacccgacacgggccg
tcataactaccatgaaggagcggagaatgggccgcatcatgtttgtatcctcccaagcgggccagattggcctgtttgga
tacaccgcctactccccatccaagtttgccctgcgtggcttagcagagtcgctgcagatggagataaagccgtacaacat
ctatgtgactgtggcctacccccctgacacggacactccaggtttggctgaggaaaataagacgaagcctctggagacta
aattaatctccgaaacatcaggagtgtgccaaccggaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaac
ttcaacagctccgtgggacctgacggttacatgctatcagccctcacctgtggcatgtcacctgtcacctctatcacaga
aggtctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgc
gccgctgcatgattcagagggagcagttaaaagcagccgacaagagggagtaa
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=1080 residues).
atgtcctctgacgaagcgttgagcgcaacgatcaccgattggcttttcatcaactcctggtggctgcttctgccattcat
catgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaac
cgctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctac
agacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagaggtggagaaatttgc
catcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaaagtgtgataaaac
aggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaagtttgaggaagtg
gaggtggaccgtttcaaaaaactgatggaagtgaactacctgggcagcgtttacccgacacgggccgtcataactaccat
gaaggagcggagaatgggccgcatcatgtttgtatcctcccaagcgggccagattggcctgtttggatacaccgcctact
ccccatccaagtttgccctgcgtggcttagcagagtcgctgcagatggagataaagccgtacaacatctatgtgactgtg
gcctacccccctgacacggacactccaggtttggctgaggaaaataagacgaagcctctggagactaaattaatctccga
aacatcaggagtgtgccaaccggaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaacagctccg
tgggacctgacggttacatgctatcagccctcacctgtggcatgtcacctgtcacctctatcacagaaggtctccagcag
attgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgat
tcagagggagcagttaaaagcagccgacaagagggagtaa
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=561 residues).
atgtcctctgacgaagcgttgagcgcaacgatcaccgattggcttttcatcaactcctggtggctgcttctgccattcat
catgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaac
cgctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctac
agacagggagcgttcatcacgttggtggcacgaaatgaggtggtgctctgcatatcggtggatgtctccagtgattacag
tcaggtggaaagtgtgataaaacaggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatcca
tctctgggaagtttgaggaagtggaggtggaccgtttcaaaattgttaccatgggattatttcggaccatcgccctcttc
tacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagttaaaagcagccgacaagagggagta
a
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-04 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=1017 residues).
atgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaacc
gctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctaca
gacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagaggtggagaaatttgcc
atcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaagtttgaggaagtgg
aggtggaccgtttcaaaaaactgatggaagtgaactacctgggcagcgtttacccgacacgggccgtcataactaccatg
aaggagcggagaatgggccgcatcatgtttgtatcctcccaagcgggccagattggcctgtttggatacaccgcctactc
cccatccaagtttgccctgcgtggcttagcagagtcgctgcagatggagataaagccgtacaacatctatgtgactgtgg
cctacccccctgacacggacactccaggtttggctgaggaaaataagacgaagcctctggagactaaattaatctccgaa
acatcaggagtgtgccaaccggaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaacagctccgt
gggacctgacggttacatgctatcagccctcacctgtggcatgtcacctgtcacctctatcacagaaggtctccagcagg
acgccttcgtggagctgtacgacagacacggggagtccgtcttcagctgctcctggccctccatcaagaccgtcttcggc
ctggctgcactcggggcggcgagcctcaccatcggagcgtacctcacgcagaagtga
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-05 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=1005 residues).
atgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaacc
gctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctaca
gacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagaggtggagaaatttgcc
atcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaagtttgaggaagtgg
aggtggaccgtttcaaaaaactgatggaagtgaactacctgggcagcgtttacccgacacgggccgtcataactaccatg
aaggagcggagaatgggccgcatcatgtttgtatcctcccaagcgggccagattggcctgtttggatacaccgcctactc
cccatccaagtttgccctgcgtggcttagcagagtcgctgcagatggagataaagccgtacaacatctatgtgactgtgg
cctacccccctgacacggacactccaggtttggctgaggaaaataagacgaagcctctggagactaaattaatctccgaa
acatcaggagtgtgccaaccggaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaacagctccgt
gggacctgacggttacatgctatcagccctcacctgtggcatgtcacctgtcacctctatcacagaaggtctccagcaga
ttgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgatt
cagagggagcagttaaaaactaaacatcccaccgcctggttgtaa
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-06 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=894 residues).
atgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaacc
gctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctaca
gacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagaggtggagaaatttgcc
atcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaagtttgaggaagtgg
aggtggaccgtttcaaaaaactgatggaagtgaactacctgggcagcgtttacccgacacgggccgtcataactaccatg
aaggagcggagaatgggccgcatcatgtttgtatcctcccaagcgggccagattggcctgtttggatacaccgcctactc
cccatccaagtttgccctgcgtggcttagcagagtcgctgcagatggagataaagccgtacaacatctatgtgactgtgg
cctacccccctgacacggacactccaggtttggctgaggaaaataagacgaagcctctggagactaaattaatctccgaa
acatcaggagtgtgccaaccggaccaagtggccaaaatcattgtgcgagatgcaattgttaccatgggattatttcggac
catcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagttaaaagcagccg
acaagagggagtaa
>gnl|bcl2dbcds|A0A8D3DC79_uncBCL2-07 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus (length=807 residues).
atgctcctggtcgtcgccgccttcattgttgccttcgtgctgctgttatacatgatatcgcctctcatcagccccaaacc
gctgaaactgaacggggcccacgtcgtggtgaccggaggctcaagtgggattgggaaatccattgcagtggagtgctaca
gacagggagcgttcatcacgttggtggcacgaaatgaggctaaactccttcaagcaaagaaagaggtggagaaatttgcc
atcaacgacaagcaggtggtgctctgcatatcggtggatgtctccagtgattacagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctggggcctgtggatatgcttgtgaactgtgctggatcatccatctctgggaagtttgaggaagtgg
aggtggaccgtttcaaaataaagccgtacaacatctatgtgactgtggcctacccccctgacacggacactccaggtttg
gctgaggaaaataagacgaagcctctggagactaaattaatctccgaaacatcaggagtgtgccaaccggaccaagtggc
caaaatcattgtgcgagatgcagtgcaggggaacttcaacagctccgtgggacctgacggttacatgctatcagccctca
cctgtggcatgtcacctgtcacctctatcacagaaggtctccagcagattgttaccatgggattatttcggaccatcgcc
ctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagttaaaagcagccgacaagag
ggagtaa
© 1998-2023Legal notice