Dataset for CDS BCL2L1 of organism Vombatus ursinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X2JXQ8_BCL2L1-      atgtcacacggcaaccgggagctggtggttgactttctttcttacaagct
A0A4X2KZ04_BCL2L1-      -------------------------------------------------c

A0A4X2JXQ8_BCL2L1-      ctcacagaaaggatacagttggagtcagtttgaagatgagaataggactg
A0A4X2KZ04_BCL2L1-      ctca-----------------------------------------aactc
                        ****                                          *** 

A0A4X2JXQ8_BCL2L1-      aggccccagaagggacagaaatacctagtactgtgaatggtagcccctct
A0A4X2KZ04_BCL2L1-      cggccccagaagggacagaaa---ctagtactgtgaatggtagcccctct
                         ********************   **************************

A0A4X2JXQ8_BCL2L1-      tggcaccctgctgacagccatgcagtgagtggggccacaggacacagcag
A0A4X2KZ04_BCL2L1-      tggcaccctgctgacaaccatgcagtgagtggggccacaggacacagcag
                        **************** *********************************

A0A4X2JXQ8_BCL2L1-      cagcctggatgcccatgagacaataccagtggctgctgtgaagcaagctt
A0A4X2KZ04_BCL2L1-      cagcctggatgcccatgagacaataccagtggctgctgtgaagcaagctt

A0A4X2JXQ8_BCL2L1-      tgagggaggcaggagatgaatttgaactccggtaccgacgggccttcagt
A0A4X2KZ04_BCL2L1-      tgaaggaggcaggagatgaatttgaactctggtaccgatgggccttcagt
                        *** ************************* ******** ***********

A0A4X2JXQ8_BCL2L1-      gacctgacatcccagctccacatcactccagggacggcttatcagagctt
A0A4X2KZ04_BCL2L1-      gacctgacatccca---------------------------------ctt
                        **************                                 ***

A0A4X2JXQ8_BCL2L1-      tgagcaggtagtgaatgaactctttcgggatggggtgaactggggccgaa
A0A4X2KZ04_BCL2L1-      tgagcaggtagtgaatgagctctttcgggatagggtgaactggggccgaa
                        ****************** ************ ******************

A0A4X2JXQ8_BCL2L1-      ttgtggcattcttctccttcggaggggcactgtgtgtggaaagcgtggat
A0A4X2KZ04_BCL2L1-      ttgtggcattcttctccttcggaggagcattgtgtgtggaacgcgtggat
                        ************************* *** *********** ********

A0A4X2JXQ8_BCL2L1-      aaggagatggaagtcttggtaggacgaatcacctcctggatggccactta
A0A4X2KZ04_BCL2L1-      aaggagatggaagtcttggtaggacgaatcacctcctggatggccactta

A0A4X2JXQ8_BCL2L1-      cttggatgaccacctagacccttggatccaagaaaatggcggttgggaca
A0A4X2KZ04_BCL2L1-      cttggatgaccacctagacccttggatctcagaaaatggcggttgggaca
                        ****************************  ********************

A0A4X2JXQ8_BCL2L1-      ccttcgtggagctttatgggaatgatgcagctgcagagagccggaagggc
A0A4X2KZ04_BCL2L1-      cctttgcggagccttatgagaataacgcagctgcggagagccgggagggc
                        **** * ***** ***** **** * ******** ********* *****

A0A4X2JXQ8_BCL2L1-      caggaacgcttcaaccgatggctgctgactggcatgacagtggctggtgt
A0A4X2KZ04_BCL2L1-      caggaaagcttcatccgatggctgctgactggcatgacagtggctggtgt
                        ****** ****** ************************************

A0A4X2JXQ8_BCL2L1-      agtcctactggggtccctattcagccggaagtga
A0A4X2KZ04_BCL2L1-      agtcctgctggggtccctattcagccggaagtga
                        ****** ***************************

© 1998-2021Legal notice