Dataset for CDS BCL2L1 of organism Vombatus ursinus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4X2JXQ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Vombatus ursinus GN=BCL2L1 (length=684 residues).
atgtcacacggcaaccgggagctggtggttgactttctttcttacaagctctcacagaaaggatacagttggagtcagtt
tgaagatgagaataggactgaggccccagaagggacagaaatacctagtactgtgaatggtagcccctcttggcaccctg
ctgacagccatgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccgacgggccttcagtgacctgacatcccagctcca
catcactccagggacggcttatcagagctttgagcaggtagtgaatgaactctttcgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcactgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgaatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggctggtgtagtcctactggggtccctattcagccggaagtga
>gnl|bcl2dbcds|A0A4X2KZ04_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Vombatus ursinus GN=BCL2L1 (length=558 residues).
cctcaaactccggccccagaagggacagaaactagtactgtgaatggtagcccctcttggcaccctgctgacaaccatgc
agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaataccagtggctgctgtgaagcaagctttga
aggaggcaggagatgaatttgaactctggtaccgatgggccttcagtgacctgacatcccactttgagcaggtagtgaat
gagctctttcgggatagggtgaactggggccgaattgtggcattcttctccttcggaggagcattgtgtgtggaacgcgt
ggataaggagatggaagtcttggtaggacgaatcacctcctggatggccacttacttggatgaccacctagacccttgga
tctcagaaaatggcggttgggacacctttgcggagccttatgagaataacgcagctgcggagagccgggagggccaggaa
agcttcatccgatggctgctgactggcatgacagtggctggtgtagtcctgctggggtccctattcagccggaagtga
© 1998-2020Legal notice