Dataset for CDS BAX-like of Organism Eptatretus burgeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4QYW9_BAX-01       atggcggaaggagga-----------------------------------
A0A8C4N758_BAK1-01      --------------------------------------------------
A0A8C4N758_BAK1-02      atgaagaagcgcaaaaaggcgcgaagccggaagaagcctcgccgaagggc
A0A8C4N758_BAK1-03      --------------------------------------------------
                                                                          

A0A8C4QYW9_BAX-01       ------------------------------------------gcttccga
A0A8C4N758_BAK1-01      --------------------------------------------------
A0A8C4N758_BAK1-02      gtgtccgatgacgtcacgcaaagaaagcccaaagggttcgttacttccgg
A0A8C4N758_BAK1-03      --------------------------------------------------
                                                                          

A0A8C4QYW9_BAX-01       gaatc---------------------------------ctggagcgggga
A0A8C4N758_BAK1-01      --------------------------------------atggccagcgga
A0A8C4N758_BAK1-02      gaatttcagtcaccctcgaaccgccgtccattctcgtgatggccagcgga
A0A8C4N758_BAK1-03      --------------------------------------atggccagcgga
                                                               ***   * ***

A0A8C4QYW9_BAX-01       gacaacatgaa-------gaggacggagacgaccccgtgtc------gag
A0A8C4N758_BAK1-01      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
A0A8C4N758_BAK1-02      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
A0A8C4N758_BAK1-03      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
                        *** ***  **         ***   *     ***    **      ***

A0A8C4QYW9_BAX-01       taagcagcga----ctcagac--ggggttccgtggctgatcggatcagcc
A0A8C4N758_BAK1-01      aactcctcgctcctctccgactgaggattcagtggttg--cagat--gcc
A0A8C4N758_BAK1-02      aactcctcgctcctctccgactgaggattcagtggttg--cagat--gcc
A0A8C4N758_BAK1-03      aactcctcgctcctctccgactgaggattcagtggttg--cagat--gcc
                         *  *  **     *** ***   ** *** **** **  * ***  ***

A0A8C4QYW9_BAX-01       agcaggccggacctctc--ctgc-------gccgtttcatcctggatcaa
A0A8C4N758_BAK1-01      g--aggcagtgtttcgcagctacgtatattgccgtgttgaacaggatgag
A0A8C4N758_BAK1-02      g--aggcagtgtttcgcagctacgtatattgccgtgttgaacaggatgag
A0A8C4N758_BAK1-03      g--aggcagtgtttcgcagctacgtatattgccgtgttgaacaggatgag
                           **** *    ** *  ** *       ***** *    * **** * 

A0A8C4QYW9_BAX-01       gc--------cgaatcggaaggtgtggataaacggcctaccttggaagat
A0A8C4N758_BAK1-01      gctcatgctgcagagcaagagggcagtgcagtcgga--gcaatggtagct
A0A8C4N758_BAK1-02      gctcatgctgcagagcaagagggcagtgcagtcgga--gcaatggtagct
A0A8C4N758_BAK1-03      gctcatgctgcagagcaagagggcagtgcagtcgga--gcaatggtagct
                        **        *  * *   ***   *   *  ***    *  *** ** *

A0A8C4QYW9_BAX-01       ctgggtggtcagcctg---gagagttgacagacaagagtatctccgaaat
A0A8C4N758_BAK1-01      ccgg--gggcagcctgtttgacacctgccatgtctgagatttttgggatt
A0A8C4N758_BAK1-02      ccgg--gggcagcctgtttgacacctgccatgtctgagatttttgggatt
A0A8C4N758_BAK1-03      ccgg--gggcagcctgtttgacacctgccatgtctgagatttttgggatt
                        * **  ** *******   ** *  ** **     ***  * *  * * *

A0A8C4QYW9_BAX-01       c-----------------------gctcag---------caaatcaagat
A0A8C4N758_BAK1-01      caggactcacctctcagtcctacggcccaggttggacgacagttggcgac
A0A8C4N758_BAK1-02      caggactcacctctcagtcctacggcccaggttggacgacagttggcgac
A0A8C4N758_BAK1-03      caggactcacctctcagtcctacggcccaggttggacgacagttggcgac
                        *                       ** ***         **  *   ** 

A0A8C4QYW9_BAX-01       cattggggatgagttgaatcggaatgccg------agcttcagcaggta-
A0A8C4N758_BAK1-01      aatcggcgatgaaattacccggcgttacgatagacagttccagcagttcc
A0A8C4N758_BAK1-02      aatcggcgatgaaattacccggcgttacgatagacagttccagcagttcc
A0A8C4N758_BAK1-03      aatcggcgatgaaattacccggcgttacgatagacagttccagcagttcc
                         ** ** *****  * *  ***  *  **      ** * ****** *  

A0A8C4QYW9_BAX-01       -ataaag----caactaccactggattctccccgcgagttgtttaagaag
A0A8C4N758_BAK1-01      tgtgcagtctccaaatcacacaggaaaacgcgtacgacgtcttccgggag
A0A8C4N758_BAK1-02      tgtgcagtctccaaatcacacaggaaaacgcgtacgacgtcttccgggag
A0A8C4N758_BAK1-03      tgtgcagtctccaaatcacacaggaaaacgcgtacgacgtcttccgggag
                          *  **    *** *  *** ***     *   ***  * **   * **

A0A8C4QYW9_BAX-01       gtcgcctgtgaaataatctcggacggaaacataaattggggccgtgtggt
A0A8C4N758_BAK1-01      atagcgatgagcctcattcaggatgga---gtgaactggggacgtattct
A0A8C4N758_BAK1-02      atagcgatgagcctcattcaggatgga---gtgaactggggacgtattct
A0A8C4N758_BAK1-03      atagcgatgagcctcattcaggatgga---gtgaactggggacgtattct
                         * **        * **   *** ***    * ** ***** *** *  *

A0A8C4QYW9_BAX-01       cacgcttttctactttacttacaagctcattatgagggcgttcagccatg
A0A8C4N758_BAK1-01      ggcgttgttagcttttggctaccgcatggcaatccatgtgttcagcaaag
A0A8C4N758_BAK1-02      ggcgttgttagcttttggctaccgcatggcaatccatgtgttcagcaaag
A0A8C4N758_BAK1-03      ggcgttgttagcttttggctaccgcatggcaatccatgtgttcagcaaag
                          ** * **    ***   ***    *    **    * ******* * *

A0A8C4QYW9_BAX-01       acttgatggacattgttcatacacttatgaactgggtactggagctg-at
A0A8C4N758_BAK1-01      gttggcacggtttctttcgccagattacttccttctt-ctgtcgcttcat
A0A8C4N758_BAK1-02      gttggcacggtttctttcgccagattacttccttctt-ctgtcgcttcat
A0A8C4N758_BAK1-03      gttggcacggtttctttcgccagattacttccttctt-ctgtcgcttcat
                          * *   *   *  ***      ***    **   * ***  ***  **

A0A8C4QYW9_BAX-01       c---tacgaccgcgttgtccagtggatcatagatcagggtggctgggagg
A0A8C4N758_BAK1-01      cctgcagaacaacatcgctaagtggattgctgagcacggaggctgggtga
A0A8C4N758_BAK1-02      cctgcagaacaacatcgctaagtggattgctgagcacggaggctgggtga
A0A8C4N758_BAK1-03      cctgcagaacaacatcgctaagtggattgctgagcacggaggctg-----
                        *    *  **  * * *   *******    ** ** ** *****     

A0A8C4QYW9_BAX-01       gtgtgc----------gtgactacatctcacgcaccaactggcagatggt
A0A8C4N758_BAK1-01      gattaccaaggggcacgtg-ctacatctccaaatc---cctgtgcaccgt
A0A8C4N758_BAK1-02      gattaccaaggggcacgtg-ctacatctccaaatc---cctgtgcaccgt
A0A8C4N758_BAK1-03      gaatgc---------tgtg-ctgcagttgaaaaac---cctttcttctgg
                        *  * *          *** ** **  *      *   *         * 

A0A8C4QYW9_BAX-01       gggaggctttgca--gccgg-agtgctgttc--agcgtcgcaatctactt
A0A8C4N758_BAK1-01      aacaaactattca-tgccagcaattttgttccatgcgttggtctctagca
A0A8C4N758_BAK1-02      aacaaactattca-tgccagcaattttgttccatgcgttggtctctagca
A0A8C4N758_BAK1-03      g------tatttgctgcctccttcattgt----tacgctcttctc-agca
                               * *     ***        ***      **      ** *   

A0A8C4QYW9_BAX-01       ggtcaagtcaaa-----------atga
A0A8C4N758_BAK1-01      tttaacgctcaacccttatccttctaa
A0A8C4N758_BAK1-02      tttaacgctcaacccttatccttctaa
A0A8C4N758_BAK1-03      -atgatgctgaa-----acggtcttga
                          * * *   **            * *

© 1998-2023Legal notice