Dataset for CDS BCL-2-like of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5FC81_BCL2L1-      atggcg--------------------------------------------
A0A8C5B4N8_BCL2L1-      atg-----------------------------------------------
D2ITA2_BCL2L1-02        atg-----------------------------------------------
A0A8C5C4C3_BCL2-01      atggcg--------------------------------------------
A0A8C5CY11_BCL2L10      atgatggccagttgtctaacctgcatcaaaatggccatctcttcca----
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-03      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-01      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-04      atgt----------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      ----------------------------------------caactggacc
A0A8C5B4N8_BCL2L1-      ----------------------------------------agcattgac-
D2ITA2_BCL2L1-02        ----------------------------------------agcattgac-
A0A8C5C4C3_BCL2-01      ----------------------------------------aacgtgtgca
A0A8C5CY11_BCL2L10      --------------------------------------gaaacatg----
D2IT42_BCL2L10-02       -------------------------------------------atg----
A0A8C5CE84_MCL1-02      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-03      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-01      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-04      ------------cggacccca-----------------gggacatagac-
                                                                    *     

A0A8C5FC81_BCL2L1-      cc------------gcccgccccttggtttcccagaaccgcgagctggtg
A0A8C5B4N8_BCL2L1-      --------------acaagcatgtcg---atcagtaacagagaactggtg
D2ITA2_BCL2L1-02        --------------acaagcatgtcg---atcagtaacagagaactggtg
A0A8C5C4C3_BCL2-01      accgcg--------------atatcg---tgcaaaagta-----------
A0A8C5CY11_BCL2L10      --------------tcgtgtaggctg---tggaaagaga-----------
D2IT42_BCL2L10-02       --------------tcgtgtaggctg---tggaaagaga-----------
A0A8C5CE84_MCL1-02      tccactccgaaggttcacacaccacg---acagaggggg-----------
A0A8C5CE84_MCL1-03      tccactccgaaggttcacacaccacg---acagaggggg-----------
A0A8C5CE84_MCL1-01      tccactccgaaggttcacacaccacg---acagaggggg-----------
A0A8C5CE84_MCL1-04      --------------------------------gaggatg-----------
                                                                          

A0A8C5FC81_BCL2L1-      ctgttctacatcacgcacaagctggc---ccagaag---------aactt
A0A8C5B4N8_BCL2L1-      ttcttcttcctaagccataaactgtc---tcagagg--------aattac
D2ITA2_BCL2L1-02        ttcttcttcctaagccataaactgtc---tcagagg--------aattac
A0A8C5C4C3_BCL2-01      --------cattttccataaactgtccaagcagggg--------------
A0A8C5CY11_BCL2L10      --------ccctggccctg----------tcagagg--------------
D2IT42_BCL2L10-02       --------ccctggccctg----------tcagagg--------------
A0A8C5CE84_MCL1-02      --------ccttgcctctaatggcgacgttcaaaagcggagacgaacgta
A0A8C5CE84_MCL1-03      --------ccttgcctctaatggcgacgttcaaaagcggagacgaacgta
A0A8C5CE84_MCL1-01      --------ccttgcctctaatggcgacgttcaaaagcggagacgaacgta
A0A8C5CE84_MCL1-04      --------ccatcc---------------tcaaaggc-------------
                                *                     **   *              

A0A8C5FC81_BCL2L1-      ccccctcaaccacctcacactggcggccacgcccccaaaccggactgagg
A0A8C5B4N8_BCL2L1-      aggcctattcccttccagcccgagggggcagatgaggggactgatgagga
D2ITA2_BCL2L1-02        aggcctattcccttccagcccgagggggcaggtgaggggactgatgagga
A0A8C5C4C3_BCL2-01      --------------------tatatgtgggaattcgaggacgctgtggag
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      aaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaa
A0A8C5CE84_MCL1-03      aaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaa
A0A8C5CE84_MCL1-01      aaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaa
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      tgggcggggccgcaccgggccccgcccgcgtccccgcgccgcacgccaac
A0A8C5B4N8_BCL2L1-      caagtccaacaggattggtaataatgggttac------------------
D2ITA2_BCL2L1-02        caagtccaacaggattggtaataatgggttac------------------
A0A8C5C4C3_BCL2-01      gaagaagaagtg----gggaataataggtcgatcatcgctcctccaccga
A0A8C5CY11_BCL2L10      --------------------actacctgttgtcctgcactgc--------
D2IT42_BCL2L10-02       --------------------actacctgttgtcctgcactgc--------
A0A8C5CE84_MCL1-02      gacgaccaagaa----ggaaacggttcgctgcctagcactcc--------
A0A8C5CE84_MCL1-03      gacgaccaagaa----ggaaacggttcgctgcctagcactcc--------
A0A8C5CE84_MCL1-01      gacgaccaagaa----ggaaacggttcgctgcctagcactcc--------
A0A8C5CE84_MCL1-04      -------------------------------ctcagctctgc--------
                                                                          

A0A8C5FC81_BCL2L1-      ggcacgccgaacggcaccaccac---cgccgccgccgccacgcccccccc
A0A8C5B4N8_BCL2L1-      ----ggttgaac--------------gacggtaacggcaatg--------
D2ITA2_BCL2L1-02        ----ggttgaac--------------gacggtaacggcaatg--------
A0A8C5C4C3_BCL2-01      ctttggtgaaacgatgtcgaggagaagtgggggacgacaacgacgccaac
A0A8C5CY11_BCL2L10      -------aag----------------cacaggcacagccccgc-------
D2IT42_BCL2L10-02       -------aag----------------cacaggcacagccccgc-------
A0A8C5CE84_MCL1-02      -------ggaactccagtcagaagtagacacggacagccaggcgggggaa
A0A8C5CE84_MCL1-03      -------ggaactccagtcagaagtagacacggacagccaggcgggggaa
A0A8C5CE84_MCL1-01      -------ggaactccagtcagaagtagacacggacagccaggcgggggaa
A0A8C5CE84_MCL1-04      -------agagct-----------------ggaacagctgg---------
                                                          *  *            

A0A8C5FC81_BCL2L1-      atcgcccccgcccaccgcgcctccgccccggcgccagtcg---tccgc--
A0A8C5B4N8_BCL2L1-      -----gccagttggcgccatcacctactcca--caaggca----------
D2ITA2_BCL2L1-02        -----gccagttggcgccatcacctactcca--caaggca----------
A0A8C5C4C3_BCL2-01      accgggccggagagcatcccccgtctttccaagcggatcacggcccgc--
A0A8C5CY11_BCL2L10      --------------cgcc---------tcccagcgagtca---gccgc--
D2IT42_BCL2L10-02       --------------cgcc---------tcccagcgagtca---gccgc--
A0A8C5CE84_MCL1-02      gaagtgttggataacgac---------accaagcgaatca---ttcgcat
A0A8C5CE84_MCL1-03      gaagtgttggataacgac---------accaagcgaatca---ttcgcat
A0A8C5CE84_MCL1-01      gaagtgttggataacgac---------accaagcgaatca---ttcgcat
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      ---------------------------------------------ggaga
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------cacggggacccgcgcgcg
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      ttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaag
A0A8C5CE84_MCL1-03      ttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaag
A0A8C5CE84_MCL1-01      ttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaag
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      cggtcgccatggcggcggtgaaggaggcgctgcgggacacggcgggcgag
A0A8C5B4N8_BCL2L1-      ---------cggaggctgtgagggcagcgcttctagaatcggtggaagag
D2ITA2_BCL2L1-02        ---------cggaggctgtgagggcagcgcttctagaatcggtggaagag
A0A8C5C4C3_BCL2-01      gcgacccaccgggtgctgcgcgag--------------gcgggggacgaa
A0A8C5CY11_BCL2L10      -------------ggccatgaggggactg---------gcccaggacatg
D2IT42_BCL2L10-02       -------------ggccatgaggggactg---------gcccaggacatg
A0A8C5CE84_MCL1-02      acgaggttcaagtgactatgagaagagtt---------gtagacggcgtg
A0A8C5CE84_MCL1-03      acgaggttcaagtgactatgagaagagtt---------gtagacggcgtg
A0A8C5CE84_MCL1-01      acgaggttcaagtgactatgagaagagtt---------gtagacggcgtg
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      ttcgagctgcgcttcacgcgggccttcagcgacctctcctcccagctgca
A0A8C5B4N8_BCL2L1-      tttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcc
D2ITA2_BCL2L1-02        tttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcc
A0A8C5C4C3_BCL2-01      ctcgagagactctaccaggcggacttcaccgagatgtcgcaccagctgta
A0A8C5CY11_BCL2L10      ---gagcggcagcactacgctcgcttccaggctctggcccagagcttcc-
D2IT42_BCL2L10-02       ---gagcggcagcactacgctcgcttccaggctctggcccagagcttcc-
A0A8C5CE84_MCL1-02      cttgaaaaacaccaatacgc---atacaagggtatgatccagaaattgga
A0A8C5CE84_MCL1-03      cttgaaaaacaccaatacgc---atacaagggtatgatccagaaattgga
A0A8C5CE84_MCL1-01      cttgaaaaacaccaatacgc---atacaagggtatgatccagaaattgga
A0A8C5CE84_MCL1-04      ----------------------------agtgtgagctccaggacctgg-
                                                                      *   

A0A8C5FC81_BCL2L1-      catcac--gccg--------gccaccgcctaccagagcttcgagagcgtc
A0A8C5B4N8_BCL2L1-      catcaccccc----------gccacggcctacggtagcttcgaaagcgtg
D2ITA2_BCL2L1-02        catcaccccc----------gccacggcctacggtagcttcgaaagcgtg
A0A8C5C4C3_BCL2-01      cctcac--gtcgactacggcgcagaggc--------ggttcagggaggtg
A0A8C5CY11_BCL2L10      ------tggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtg
D2IT42_BCL2L10-02       ------tggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtg
A0A8C5CE84_MCL1-02      attggacggccgaggggaagacatgagttttgtcacgtct-------gtg
A0A8C5CE84_MCL1-03      attggacggccgaggggaagacatgagttttgtcacgtct-------gtg
A0A8C5CE84_MCL1-01      attggacggccgaggggaagacatgagttttgtcacgtct-------gtg
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      atggacgaggtgttccgcgacggc---gtcaactggggccgcgtggtggg
A0A8C5B4N8_BCL2L1-      atggacgaggtgttcagggacagc---atcaactggggacgcatagtggg
D2ITA2_BCL2L1-02        atggacgaggtgttcagggacagc---atcaactggggacgcatagtggg
A0A8C5C4C3_BCL2-01      atcgacgagctgttcagggacggc---gtgaactggggccggatcatcgc
A0A8C5CY11_BCL2L10      atggaggagctggtgggagacggacagttgaactgggggagggtagtttc
D2IT42_BCL2L10-02       atggaggagctggtgggagacggacagttgaactgggggagggtagtttc
A0A8C5CE84_MCL1-02      gccaagagtctcttcgcagacagcacaacaaactgggggcgtatcgccag
A0A8C5CE84_MCL1-03      gccaagagtctcttcgcagacagcacaacaaactgggggcgtatcgccag
A0A8C5CE84_MCL1-01      gccaagagtctcttcgcagacagcacaacaaactgggggcgtatcgccag
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      cctgtttgcctttggcggcgccctgtgcgtggagtgcgt-----------
A0A8C5B4N8_BCL2L1-      cctgtttgccttcgggggggccctctgcgtggagtgtgt-----------
D2ITA2_BCL2L1-02        cctgtttgccttcgggggggccctctgcgtggagtgtgt-----------
A0A8C5C4C3_BCL2-01      atttttcgagttcgggggtacagtgtgcgtggagtgcgccggcggccagg
A0A8C5CY11_BCL2L10      cctcttcacctttaccggggtgctg------------gccagacaactgc
D2IT42_BCL2L10-02       cctcttcacctttaccggggtgctg------------gccagacaactgc
A0A8C5CE84_MCL1-02      cctggtggccttcggagcagcgttgtgt-----cagtacctagaggccag
A0A8C5CE84_MCL1-03      cctggtggccttcggagcagcgttgtgt-----cagtacctagaggccag
A0A8C5CE84_MCL1-01      cctggtggccttcggagcagcgttgtgt-----cagtacctagaggccag
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      -ggagaaggaga--tgagctccctggttggg-------------------
A0A8C5B4N8_BCL2L1-      -ggagaaggaga--tgagccacatggtgccc-------------------
D2ITA2_BCL2L1-02        -ggagaaggaga--tgagccacatggtgccc-------------------
A0A8C5C4C3_BCL2-01      aggaggagatgg--tggcgcaagtggag----------------------
A0A8C5CY11_BCL2L10      aggagaagaagg--gggtacaactgggg----------------------
D2IT42_BCL2L10-02       aggagaagaagg--gggtacaactgggg----------------------
A0A8C5CE84_MCL1-02      gggtaaagaaggctgcgtgtcgctggtggccgaggagatttcctcatacc
A0A8C5CE84_MCL1-03      gggtaaagaaggctgcgtgtcgctggtggccgaggagatttcctcatacc
A0A8C5CE84_MCL1-01      gggtaaagaaggctgcgtgtcgctggtggccgaggagatttcctcatacc
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5FC81_BCL2L1-      ------cgcatcgccgagtggatgacggtgta---------cctgga---
A0A8C5B4N8_BCL2L1-      ------cgcgtggcagagtggatgaccaggta---------cctgga---
D2ITA2_BCL2L1-02        ------cgcgtggcagagtggatgaccaggta---------cctgga---
A0A8C5C4C3_BCL2-01      ------cacatcgccgagtggatgactgagta---------catgaa---
A0A8C5CY11_BCL2L10      ------caggaccccgg--gacgggcagggca---------ctggga---
D2IT42_BCL2L10-02       ------caggaccccgg--gacgggcagggca---------ctggga---
A0A8C5CE84_MCL1-02      tcctttcagaccaacgg--gaatggttggtcaaaaacaactcatggg---
A0A8C5CE84_MCL1-03      tcctttcagaccaacgg--gaatggttggtcaaaaacaactcatggg---
A0A8C5CE84_MCL1-01      tcctttcagaccaacgg--gaatggttggtcaaaaacaactcatggaatg
A0A8C5CE84_MCL1-04      --------------------------------------accccgagaatg
                                                                 *        

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      -caggttcccggcgggagctgcagggggctggcggagacgatag------
D2IT42_BCL2L10-02       -caggttcccggcgggagctgcagggggctggcggagacgatag------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      ccatgctcccagcgg--gctaccggcagcgggaccagaccaagaagaccc
A0A8C5CE84_MCL1-04      ccatgctcccagcgg--gctaccggcagcgggaccagaccaagaagaccc
                                                                          

A0A8C5FC81_BCL2L1-      ------------------------------cgtgc---------------
A0A8C5B4N8_BCL2L1-      -------------------------------cgaccacattga-------
D2ITA2_BCL2L1-02        -------------------------------cgaccacattga-------
A0A8C5C4C3_BCL2-01      ------------------------------cgggc---------------
A0A8C5CY11_BCL2L10      ------------------------------cggactacctaggggag---
D2IT42_BCL2L10-02       ------------------------------cggactacctaggggag---
A0A8C5CE84_MCL1-02      ------------------------------agggcttcgtaga-------
A0A8C5CE84_MCL1-03      ------------------------------agggcttcgtaga-------
A0A8C5CE84_MCL1-01      ccacgggggactatgaccgcgacgccctgcaggactacctggagaagagc
A0A8C5CE84_MCL1-04      ccacgggggactatgaccgcgacgccctgcaggactacctggagaagagc
                                                          *               

A0A8C5FC81_BCL2L1-      -------------------------acatccagccctggatccaggcgca
A0A8C5B4N8_BCL2L1-      --------------------------------ccactggatccagagcaa
D2ITA2_BCL2L1-02        --------------------------------ccactggatccagagcaa
A0A8C5C4C3_BCL2-01      -------------------------atctgaacaactggatccaggacaa
A0A8C5CY11_BCL2L10      ------------gagaagagggactggctgct------------ggagaa
D2IT42_BCL2L10-02       ------------gagaagagggactggctgct------------ggagaa
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gccctggagcacgaggacagggaagacctgatccccttcaccggggagaa
A0A8C5CE84_MCL1-04      gccctggagcacgaggacagggaagacctgatccccttcaccggggagaa
                                                                          

A0A8C5FC81_BCL2L1-      ggggggatgggagcgtttctccg---------------------------
A0A8C5B4N8_BCL2L1-      cggaggatggaaacactttgctg---------------------------
D2ITA2_BCL2L1-02        cggaggatggaaacactttgctg---------------------------
A0A8C5C4C3_BCL2-01      cgggggatgggagtccttcgtg----------------------------
A0A8C5CY11_BCL2L10      cgggggctgggaagggttttgta---------------------------
D2IT42_BCL2L10-02       cgggggctgggaagggttttgta---------------------------
A0A8C5CE84_MCL1-02      ---------------gttttttc---------------------------
A0A8C5CE84_MCL1-03      ---------------gttttttc---------------------------
A0A8C5CE84_MCL1-01      gaaag---ggaaggcgtttgttcccacggcgaccgggcagatccccctaa
A0A8C5CE84_MCL1-04      gaaaggtaggaaggcgtttgttcccacggcgaccgggcagatccccctaa
                                        **                                

A0A8C5FC81_BCL2L1-      ---------------------------------aggtgtttgggaaggac
A0A8C5B4N8_BCL2L1-      ---------------------------------cggtttttggaagcgac
D2ITA2_BCL2L1-02        ---------------------------------cggtttttggaagcgac
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      ---------------------------------agttctccaggatcgcc
D2IT42_BCL2L10-02       ---------------------------------agttctccaggatcgcc
A0A8C5CE84_MCL1-02      -------------------------------------------gagtgtc
A0A8C5CE84_MCL1-03      -------------------------------------------gagtgtc
A0A8C5CE84_MCL1-01      gcgagcagatcaccctggagccggagctggaagaggccctgaagaacgcc
A0A8C5CE84_MCL1-04      gcgagcagatcaccctggagccggagctggaagaggccctgaagaacgcc
                                                                          

A0A8C5FC81_BCL2L1-      gcggcggccgagagccggcgt-----------------------------
A0A8C5B4N8_BCL2L1-      gc------------------------------------------------
D2ITA2_BCL2L1-02        gc------------------------------------------------
A0A8C5C4C3_BCL2-01      ---------gagctgtacgaca----------------------------
A0A8C5CY11_BCL2L10      c--------gagaggtg---------------------------------
D2IT42_BCL2L10-02       c--------gagaggtg---------------------------------
A0A8C5CE84_MCL1-02      a--gaccctgagac------------------------------------
A0A8C5CE84_MCL1-03      a--gaccctgagac------------------------------------
A0A8C5CE84_MCL1-01      actgacgctgagatgtgcgacatcgcagctatccttggaatgtataccct
A0A8C5CE84_MCL1-04      actgacgctgagatgtgcgacatcgcagctatccttggaatgtataccct
                                                                          

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gatgagcaacaagcagtactatgatgctctgggttgcacggggaagatcg
A0A8C5CE84_MCL1-04      gatgagcaacaagcagtactatgatgctctgggttgcacggggaagatcg
                                                                          

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      ccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaagatc
A0A8C5CE84_MCL1-04      ccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaagatc
                                                                          

A0A8C5FC81_BCL2L1-      --------------------------------------tcccaggag---
A0A8C5B4N8_BCL2L1-      --------------------------------------ggcagcggg---
D2ITA2_BCL2L1-02        --------------------------------------ggcagcggg---
A0A8C5C4C3_BCL2-01      --------------------------------------gacagcgggg--
A0A8C5CY11_BCL2L10      --------------------------------------aaccaaga----
D2IT42_BCL2L10-02       --------------------------------------aaccaaga----
A0A8C5CE84_MCL1-02      --------------------------------------gaccgtg-----
A0A8C5CE84_MCL1-03      --------------------------------------gaccgtg-----
A0A8C5CE84_MCL1-01      tttccggaagagcccccaaacaccaccaacgtggaggagaccgtggagag
A0A8C5CE84_MCL1-04      tttccggaagagcccccaaacaccaccaacgtggaggagaccgtggagag
                                                                *   *     

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gatccacaacaacgacagtggtctgacggaggtcaacctcaacaacatca
A0A8C5CE84_MCL1-04      gatccacaacaacgacagtggtctgacggaggtcaacctcaacaacatca
                                                                          

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      ---------------------------------------------agaaa
A0A8C5CE84_MCL1-03      ---------------------------------------------agaaa
A0A8C5CE84_MCL1-01      aggacattcccatccccacgctgaaggaggtgtttgaggccatgaaggga
A0A8C5CE84_MCL1-04      aggacattcccatccccacgctgaaggaggtgtttgaggccatgaaggga
                                                                          

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      tacactcatg----------------------------------------
A0A8C5CE84_MCL1-03      tacactcatg----------------------------------------
A0A8C5CE84_MCL1-01      aactcttacgttgagatcctgagcatcgcagccacacggagcaacgaccc
A0A8C5CE84_MCL1-04      aactcttacgttgagatcctgagcatcgcagccacacggagcaacgaccc
                                                                          

A0A8C5FC81_BCL2L1-      ----agcttcaggaagtggttcctggcg----------------------
A0A8C5B4N8_BCL2L1-      ----agcgaggcgtacccgggacagtca----------------------
D2ITA2_BCL2L1-02        ----agcgaggcgtacccgggacagtca----------------------
A0A8C5C4C3_BCL2-01      ----gtcggcgttcagctgtgcctggcc----------------------
A0A8C5CY11_BCL2L10      ----gtcttcga-----tgaagacggcg----------------------
D2IT42_BCL2L10-02       ----gtcttcga-----tgaagacggcg----------------------
A0A8C5CE84_MCL1-02      ----gcctttgc-----tggatttgctg----------------------
A0A8C5CE84_MCL1-03      ----gcctttgc-----tggatttgctg----------------------
A0A8C5CE84_MCL1-01      cgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctccaga
A0A8C5CE84_MCL1-04      cgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctccaga
                              *           *     *                         

A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A8C5CY11_BCL2L10      --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gtcttaacattgagtctaacttcatcaccgcagagggcatgaaggctgta
A0A8C5CE84_MCL1-04      gtcttaacattgagtctaacttcatcaccgcagagggcatgaaggctgta
                                                                          

A0A8C5FC81_BCL2L1-      ---------------gggatgaccctgttcacg-----------------
A0A8C5B4N8_BCL2L1-      --------------caggagatggatgctggtg-----------------
D2ITA2_BCL2L1-02        --------------caggagatggatgctggtg-----------------
A0A8C5C4C3_BCL2-01      -----------ctccatcaggaccgtgtttg-------------------
A0A8C5CY11_BCL2L10      ------------------------ctgttcgcg-----------------
D2IT42_BCL2L10-02       ------------------------ctgttcgcg-----------------
A0A8C5CE84_MCL1-02      ------------------------gtattggtgcaac-------------
A0A8C5CE84_MCL1-03      ------------------------gtattggtgcaac-------------
A0A8C5CE84_MCL1-01      gtcaaggccatggccagcaacgccacgctggtggagctcaagatcgacaa
A0A8C5CE84_MCL1-04      gtcaaggccatggccagcaacgccacgctggtggagctcaagatcgacaa
                                                    *                     

A0A8C5FC81_BCL2L1-      ----------------------------------------ggg--gtcgt
A0A8C5B4N8_BCL2L1-      ----------------------------------------ggc--gcggt
D2ITA2_BCL2L1-02        ----------------------------------------ggc--gcggc
A0A8C5C4C3_BCL2-01      ----------------------------------------gtctggccgc
A0A8C5CY11_BCL2L10      ----------------------------------------gcc--gccgg
D2IT42_BCL2L10-02       ----------------------------------------gcc--gccgg
A0A8C5CE84_MCL1-02      ------------------------------------aattgcc-------
A0A8C5CE84_MCL1-03      ------------------------------------aattgcc-------
A0A8C5CE84_MCL1-01      ccagaggcacaccctgggagactcggtggagatggagatcgcc--gccat
A0A8C5CE84_MCL1-04      ccagaggcacaccctgggagactcggtggagatggagatcgcc--gccat
                                                                *         

A0A8C5FC81_BCL2L1-      ggtg----------------------------------------------
A0A8C5B4N8_BCL2L1-      gctgctgact----------------------------------------
D2ITA2_BCL2L1-02        gctgctgact----------------------------------------
A0A8C5C4C3_BCL2-01      gctgg---------------------------------------------
A0A8C5CY11_BCL2L10      ggtgg---------------------------------------------
D2IT42_BCL2L10-02       ggtgg---------------------------------------------
A0A8C5CE84_MCL1-02      ---------------------------------ctactaatc--------
A0A8C5CE84_MCL1-03      ---------------------------------ctactaatc--------
A0A8C5CE84_MCL1-01      gctggagaacaactccagcatcctgaagttcggctaccacttcacccagc
A0A8C5CE84_MCL1-04      gctggagaacaactccagcatcctgaagttcggctaccacttcacccagc
                                                                          

A0A8C5FC81_BCL2L1-      --gggtca----------------------------------------ct
A0A8C5B4N8_BCL2L1-      --ggggtgctgctcggggct----------------------------ct
D2ITA2_BCL2L1-02        --ggggtgctgctcggggct----------------------------ct
A0A8C5C4C3_BCL2-01      --gcgccgccagcctcaccat---------------------------tg
A0A8C5CY11_BCL2L10      --gcatcgcaggcctgacgttccttt----------------------tg
D2IT42_BCL2L10-02       --gcatcgcaggcctgacgttccttt----------------------tg
A0A8C5CE84_MCL1-02      --aggtga------------------------------------------
A0A8C5CE84_MCL1-03      --aggtcagagggccaagtctccaggg---------agaagaacagaaat
A0A8C5CE84_MCL1-01      aggggccccgggcccgggccgccatggccgtcaccaggaacaacgatatg
A0A8C5CE84_MCL1-04      aggggccccgggcccgggccgccatggccgtcaccaggaacaacgatatg
                                                                          

A0A8C5FC81_BCL2L1-      cttcgccca--gaaacgcctctga
A0A8C5B4N8_BCL2L1-      gctcgccaa--gaaacatgtctag
D2ITA2_BCL2L1-02        gctcgccaa--gaaacatgtctag
A0A8C5C4C3_BCL2-01      gcgcg-tacctcactcagaagtga
A0A8C5CY11_BCL2L10      gtgcgctag---------------
D2IT42_BCL2L10-02       gtgcgctag---------------
A0A8C5CE84_MCL1-02      ------------------------
A0A8C5CE84_MCL1-03      ttaccccaacagacgtaa------
A0A8C5CE84_MCL1-01      cttcgccaacagaggctgagatga
A0A8C5CE84_MCL1-04      cttcgccaacagaggctgagatga
                                                

© 1998-2022Legal notice