Dataset for CDS BCL-2-like of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D2ITA2_BCL2L1-02       atga----------------------------------------------
D2IT42_BCL2L10-02      atgtcgt-------------------------------------------
D2ITA0_MCL1-02         atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
D2ITA0_MCL1-03         atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
D2ITA0_MCL1-01         atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
D2ITA0_MCL1-04         atgt----------------------------------------------
                       ***                                               

D2ITA2_BCL2L1-02       ---------gcattgacacaagcatgtcgatcagtaacagagaactggtg
D2IT42_BCL2L10-02      ------------------------------------gtaggctgtgga--
D2ITA0_MCL1-02         ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
D2ITA0_MCL1-03         ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
D2ITA0_MCL1-01         ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
D2ITA0_MCL1-04         ------------cggacccca-----------------gggacatagac-
                                                                     *   

D2ITA2_BCL2L1-02       ttcttcttcctaagccataaactgtctcagaggaattacaggcctattcc
D2IT42_BCL2L10-02      ------------------------------aag------agaccctggcc
D2ITA0_MCL1-02         tccactccgaaggttcacacaccacgacagagg------gggccttgcct
D2ITA0_MCL1-03         tccactccgaaggttcacacaccacgacagagg------gggccttgcct
D2ITA0_MCL1-01         tccactccgaaggttcacacaccacgacagagg------gggccttgcct
D2ITA0_MCL1-04         -----------------------------gagg------atgccatcc--
                                                     * *         **      

D2ITA2_BCL2L1-02       cttccag------cccgagg------------------------------
D2IT42_BCL2L10-02      ctg----------tcagagg------------------------------
D2ITA0_MCL1-02         ctaatggcgacgttcaaaagcggagacgaacgtaaaccaagacccacgga
D2ITA0_MCL1-03         ctaatggcgacgttcaaaagcggagacgaacgtaaaccaagacccacgga
D2ITA0_MCL1-01         ctaatggcgacgttcaaaagcggagacgaacgtaaaccaagacccacgga
D2ITA0_MCL1-04         -------------tcaaaggc-----------------------------
                                     *  * *                              

D2ITA2_BCL2L1-02       ---------gggcaggtgaggggactgatgaggacaagtccaacagg---
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         actaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaa
D2ITA0_MCL1-03         actaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaa
D2ITA0_MCL1-01         actaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaa
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       attggtaataatgggttacggttgaacgacggt--------aacggcaat
D2IT42_BCL2L10-02      actacctgttgtcctgcactgcaag----------------cacaggcac
D2ITA0_MCL1-02         acggttcgctgcctagcactccggaactccagtcagaagtagacacggac
D2ITA0_MCL1-03         acggttcgctgcctagcactccggaactccagtcagaagtagacacggac
D2ITA0_MCL1-01         acggttcgctgcctagcactccggaactccagtcagaagtagacacggac
D2ITA0_MCL1-04         -----------ctcagctctgcagagct-----------------ggaac
                                         *                             * 

D2ITA2_BCL2L1-02       ggccagttggcgc----------------catcacctactccacaaggca
D2IT42_BCL2L10-02      agccccgc---------------------cgcctcccagcgagtcagccg
D2ITA0_MCL1-02         agccaggcgggggaagaagtgttggataacgacaccaagcgaatcattcg
D2ITA0_MCL1-03         agccaggcgggggaagaagtgttggataacgacaccaagcgaatcattcg
D2ITA0_MCL1-01         agccaggcgggggaagaagtgttggataacgacaccaagcgaatcattcg
D2ITA0_MCL1-04         agctgg--------------------------------------------
                        **                                               

D2ITA2_BCL2L1-02       c-------------------------------------------------
D2IT42_BCL2L10-02      c-------------------------------------------------
D2ITA0_MCL1-02         catttttctcagagactatgcaggggcatcaaaagctaaaaggacaagac
D2ITA0_MCL1-03         catttttctcagagactatgcaggggcatcaaaagctaaaaggacaagac
D2ITA0_MCL1-01         catttttctcagagactatgcaggggcatcaaaagctaaaaggacaagac
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       -------------ggaggctgtgagggcagcgcttctagaatcggtggaa
D2IT42_BCL2L10-02      ----------------ggccatgaggggactggcccaggacatg---gag
D2ITA0_MCL1-02         aagacgaggttcaagtgactatgagaagagttgtagacggcgtgcttgaa
D2ITA0_MCL1-03         aagacgaggttcaagtgactatgagaagagttgtagacggcgtgcttgaa
D2ITA0_MCL1-01         aagacgaggttcaagtgactatgagaagagttgtagacggcgtgcttgaa
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       gagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagct
D2IT42_BCL2L10-02      cggc--------agcactacgctcgcttccaggctc----tggcccagag
D2ITA0_MCL1-02         aaac--------accaatacgc---atacaagggta----tgatccagaa
D2ITA0_MCL1-03         aaac--------accaatacgc---atacaagggta----tgatccagaa
D2ITA0_MCL1-01         aaac--------accaatacgc---atacaagggta----tgatccagaa
D2ITA0_MCL1-04         ------------------------------agtgtg----agctccagga
                                                     **         *  ****  

D2ITA2_BCL2L1-02       gccca-------tcacccccgccacggcctacggt------agcttcgaa
D2IT42_BCL2L10-02      cttcc-------tggcccagtgcgaggccgacgcatgcgccggcctccgc
D2ITA0_MCL1-02         attggaattggacggccgaggggaagacatgagttttgtcacgtct----
D2ITA0_MCL1-03         attggaattggacggccgaggggaagacatgagttttgtcacgtct----
D2ITA0_MCL1-01         attggaattggacggccgaggggaagacatgagttttgtcacgtct----
D2ITA0_MCL1-04         cctgg---------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       agcgtgatggacgaggtgttcagggacagca---tcaactggggacgcat
D2IT42_BCL2L10-02      aaggtgatggaggagctggtgggagacggacagttgaactgggggagggt
D2ITA0_MCL1-02         ---gtggccaagagtctcttcgcagacagcacaacaaactgggggcgtat
D2ITA0_MCL1-03         ---gtggccaagagtctcttcgcagacagcacaacaaactgggggcgtat
D2ITA0_MCL1-01         ---gtggccaagagtctcttcgcagacagcacaacaaactgggggcgtat
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       agtgggcctgtttgccttcgggggggccctctgcgtgga----------g
D2IT42_BCL2L10-02      agtttccctcttcacctttaccggggtgctg-------gccagacaactg
D2ITA0_MCL1-02         cgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggcca
D2ITA0_MCL1-03         cgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggcca
D2ITA0_MCL1-01         cgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggcca
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       tgtgtggagaaggagatgagccacatggtg--------------------
D2IT42_BCL2L10-02      caggagaagaagg--gggtacaac-tgggg--------------------
D2ITA0_MCL1-02         ggggtaaagaaggctgcgtgtcgc-tggtggccgaggagatttcctcata
D2ITA0_MCL1-03         ggggtaaagaaggctgcgtgtcgc-tggtggccgaggagatttcctcata
D2ITA0_MCL1-01         ggggtaaagaaggctgcgtgtcgc-tggtggccgaggagatttcctcata
D2ITA0_MCL1-04         --------------------------------------------------
                                                                         

D2ITA2_BCL2L1-02       -------------ccccgcg--tggcagag-------------tggatga
D2IT42_BCL2L10-02      --------caggaccccgggacgggcagggca---------ctggga---
D2ITA0_MCL1-02         cctcctttcagaccaacgggaatggttggtcaaaaacaactcatggg---
D2ITA0_MCL1-03         cctcctttcagaccaacgggaatggttggtcaaaaacaactcatggg---
D2ITA0_MCL1-01         cctcctttcagaccaacgggaatggttggtcaaaaacaactcatggaatg
D2ITA0_MCL1-04         --------------------------------------accccgagaatg
                                                                    *    

D2ITA2_BCL2L1-02       ccaggtacctgg--------------------------------------
D2IT42_BCL2L10-02      -caggttcccggcgggagctgcagggggctggcggagacgatag------
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         ccatgctcccagcgg--gctaccggcagcgggaccagaccaagaagaccc
D2ITA0_MCL1-04         ccatgctcccagcgg--gctaccggcagcgggaccagaccaagaagaccc
                                                                         

D2ITA2_BCL2L1-02       ------------------------------acgaccacattga-------
D2IT42_BCL2L10-02      ------------------------------cggactacctaggggag---
D2ITA0_MCL1-02         ------------------------------agggcttcgtaga-------
D2ITA0_MCL1-03         ------------------------------agggcttcgtaga-------
D2ITA0_MCL1-01         ccacgggggactatgaccgcgacgccctgcaggactacctggagaagagc
D2ITA0_MCL1-04         ccacgggggactatgaccgcgacgccctgcaggactacctggagaagagc
                                                       * *  * * *        

D2ITA2_BCL2L1-02       --------------------------------ccactggatccagagcaa
D2IT42_BCL2L10-02      ------------gagaagagggactggctgct------------ggagaa
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         gccctggagcacgaggacagggaagacctgatccccttcaccggggagaa
D2ITA0_MCL1-04         gccctggagcacgaggacagggaagacctgatccccttcaccggggagaa
                                                                         

D2ITA2_BCL2L1-02       cggaggatggaaacactttgctg---------------------------
D2IT42_BCL2L10-02      cgggggctgggaagggttttgta---------------------------
D2ITA0_MCL1-02         ---------------gttttttc---------------------------
D2ITA0_MCL1-03         ---------------gttttttc---------------------------
D2ITA0_MCL1-01         gaaag---ggaaggcgtttgttcccacggcgaccgggcagatccccctaa
D2ITA0_MCL1-04         gaaaggtaggaaggcgtttgttcccacggcgaccgggcagatccccctaa
                                       ***  *                            

D2ITA2_BCL2L1-02       ---------------------------------cggtttttggaagcgac
D2IT42_BCL2L10-02      ---------------------------------agttctccaggatcgcc
D2ITA0_MCL1-02         -------------------------------------------gagtgtc
D2ITA0_MCL1-03         -------------------------------------------gagtgtc
D2ITA0_MCL1-01         gcgagcagatcaccctggagccggagctggaagaggccctgaagaacgcc
D2ITA0_MCL1-04         gcgagcagatcaccctggagccggagctggaagaggccctgaagaacgcc
                                                                   *  * *

D2ITA2_BCL2L1-02       gcggcagcgggagcgaggcg------------------------------
D2IT42_BCL2L10-02      c--------ga---gaggtg------------------------------
D2ITA0_MCL1-02         a--gaccctga---gac---------------------------------
D2ITA0_MCL1-03         a--gaccctga---gac---------------------------------
D2ITA0_MCL1-01         actgacgctga---gatgtgcgacatcgcagctatccttggaatgtatac
D2ITA0_MCL1-04         actgacgctga---gatgtgcgacatcgcagctatccttggaatgtatac
                                *    **                                  

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         cctgatgagcaacaagcagtactatgatgctctgggttgcacggggaaga
D2ITA0_MCL1-04         cctgatgagcaacaagcagtactatgatgctctgggttgcacggggaaga
                                                                         

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         tcgccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaag
D2ITA0_MCL1-04         tcgccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaag
                                                                         

D2ITA2_BCL2L1-02       -----------------------------------------tacccggg-
D2IT42_BCL2L10-02      -----------------------------------------aaccaaga-
D2ITA0_MCL1-02         -----------------------------------------gaccgtg--
D2ITA0_MCL1-03         -----------------------------------------gaccgtg--
D2ITA0_MCL1-01         atctttccggaagagcccccaaacaccaccaacgtggaggagaccgtgga
D2ITA0_MCL1-04         atctttccggaagagcccccaaacaccaccaacgtggaggagaccgtgga
                                                                 ***  *  

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         gaggatccacaacaacgacagtggtctgacggaggtcaacctcaacaaca
D2ITA0_MCL1-04         gaggatccacaacaacgacagtggtctgacggaggtcaacctcaacaaca
                                                                         

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         ------------------------------------------------ag
D2ITA0_MCL1-03         ------------------------------------------------ag
D2ITA0_MCL1-01         tcaaggacattcccatccccacgctgaaggaggtgtttgaggccatgaag
D2ITA0_MCL1-04         tcaaggacattcccatccccacgctgaaggaggtgtttgaggccatgaag
                                                                         

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         aaatacactcatg-------------------------------------
D2ITA0_MCL1-03         aaatacactcatg-------------------------------------
D2ITA0_MCL1-01         ggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacga
D2ITA0_MCL1-04         ggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacga
                                                                         

D2ITA2_BCL2L1-02       -------acagtcac-----aggagatgg---------------------
D2IT42_BCL2L10-02      -------gtcttcga-----tgaagacggcg-------------------
D2ITA0_MCL1-02         -------gcctttgc-----tggatttgctg-------------------
D2ITA0_MCL1-03         -------gcctttgc-----tggatttgctg-------------------
D2ITA0_MCL1-01         ccccgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctcc
D2ITA0_MCL1-04         ccccgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctcc
                                  *         * *   *                      

D2ITA2_BCL2L1-02       --------------------------------------------------
D2IT42_BCL2L10-02      --------------------------------------------------
D2ITA0_MCL1-02         --------------------------------------------------
D2ITA0_MCL1-03         --------------------------------------------------
D2ITA0_MCL1-01         agagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggct
D2ITA0_MCL1-04         agagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggct
                                                                         

D2ITA2_BCL2L1-02       ---------------------------atgctggtg--------------
D2IT42_BCL2L10-02      ---------------------------ctgttcgcg--------------
D2ITA0_MCL1-02         ---------------------------gtattggtgcaac----------
D2ITA0_MCL1-03         ---------------------------gtattggtgcaac----------
D2ITA0_MCL1-01         gtagtcaaggccatggccagcaacgccacgctggtggagctcaagatcga
D2ITA0_MCL1-04         gtagtcaaggccatggccagcaacgccacgctggtggagctcaagatcga
                                                      * * *              

D2ITA2_BCL2L1-02       -------------------------------------------ggcgcgg
D2IT42_BCL2L10-02      -------------------------------------------gccgccg
D2ITA0_MCL1-02         ---------------------------------------aattgcc----
D2ITA0_MCL1-03         ---------------------------------------aattgcc----
D2ITA0_MCL1-01         caaccagaggcacaccctgggagactcggtggagatggagatcgccgcca
D2ITA0_MCL1-04         caaccagaggcacaccctgggagactcggtggagatggagatcgccgcca
                                                                  * *    

D2ITA2_BCL2L1-02       cgctgc--------------------------------------------
D2IT42_BCL2L10-02      gggtgg--------------------------------------------
D2ITA0_MCL1-02         ----------------------------------ctactaatc-------
D2ITA0_MCL1-03         ----------------------------------ctactaatc-------
D2ITA0_MCL1-01         tgctggagaacaactccagcatcctgaagttcggctaccacttcacccag
D2ITA0_MCL1-04         tgctggagaacaactccagcatcctgaagttcggctaccacttcacccag
                                                                         

D2ITA2_BCL2L1-02       ---tgactggggtgctgctcggggctctgct-------------------
D2IT42_BCL2L10-02      ---gcatcgcag----gcctgacgttccttt-------------------
D2ITA0_MCL1-02         ---aggtga-----------------------------------------
D2ITA0_MCL1-03         ---aggtcagag----ggccaagtctccaggg---------agaagaaca
D2ITA0_MCL1-01         caggggccccgg----gcccgggccgccatggccgtcaccaggaacaacg
D2ITA0_MCL1-04         caggggccccgg----gcccgggccgccatggccgtcaccaggaacaacg
                                                                         

D2ITA2_BCL2L1-02       --------cgccaagaaacatgtctag--
D2IT42_BCL2L10-02      ---tggtgcgctag---------------
D2ITA0_MCL1-02         -----------------------------
D2ITA0_MCL1-03         gaaatttaccccaacagacgtaa------
D2ITA0_MCL1-01         atatgcttcgccaacagaggctgagatga
D2ITA0_MCL1-04         atatgcttcgccaacagaggctgagatga
                                                    

© 1998-2022Legal notice