Dataset for CDS BCL-2-like of organism Marmota marmota marmota

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5YJP3_BCL2A1-      atgaatgactgtga------------------------------gttcag
A0A8C5YLY6_BCL2L1-      atagagagttgtggtaggacagga---aggaacctggaactagtgatgga
A0A8C5YTS1_BCL2-01      atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A8C6EVC2_BCL2L10      atggc------------------------------agacctgctgcagga
                        **                                          *     

A0A8C5YJP3_BCL2A1-      gttcatccac---atgctggctcag---gactac----------ctgcag
A0A8C5YLY6_BCL2L1-      ctttctgtcctacaagctttcccagaaaggatac--------cgctggag
A0A8C5YTS1_BCL2-01      gtacatccactataagctgtcacagaggggctacgagtgggatgctggag
A0A8C6EVC2_BCL2L10      gcgcaccgcc---gagctg---ctgaccgactac----------ctgga-
                                 *     ***    * *   *  ***          *** * 

A0A8C5YJP3_BCL2A1-      c-----acgtcctg----caggtaccg-----------caacgtgggtca
A0A8C5YLY6_BCL2L1-      ccagtttagccgtgaggaagagaaccgcgttcaagccccagaaagggctg
A0A8C5YTS1_BCL2-01      acgtgggcgctgcgtccccaggagccg----c---cccc-----gggccg
A0A8C6EVC2_BCL2L10      ------gtactgtg--cccgggagccgggcac---cccc-----gagccg
                                     *       *  ***           *     * *   

A0A8C5YJP3_BCL2A1-      ag------------------------------------------------
A0A8C5YLY6_BCL2L1-      ----------aatcagaagaggggcccagcaatgccaccagcggcaaccc
A0A8C5YTS1_BCL2-01      ggcatcttctcttcccaaccgggnnnnnnnccggccgccaggacctcgcc
A0A8C6EVC2_BCL2L10      -------------------------------ccgccgtc-------cact
                                                                          

A0A8C5YJP3_BCL2A1-      -tcccaacaaaacgtccaaagtgttacaaaacgtggctttctcagtccaa
A0A8C5YLY6_BCL2L1-      atcccggcatcagggggacagtcccatggtgagtggagccgctggccata
A0A8C5YTS1_BCL2-01      cccccggcc-ccccgctgccgccgcggggcccgtgctcagcccggtgcca
A0A8C6EVC2_BCL2L10      cccgaggccgccctgctg-cgctccgcggcc--------gcccggttaca
                          *    *            *                       *    *

A0A8C5YJP3_BCL2A1-      aaagaagttgaaaagaatc-------------------------------
A0A8C5YLY6_BCL2L1-      acaggagtttggatgcccccgacgtggtccccatggtagcagtgaagcaa
A0A8C5YTS1_BCL2-01      cctgtggtccacctgaccc--------tccgcc-----------------
A0A8C6EVC2_BCL2L10      acagcaat--acgagccct--------tcttct-----------------
                           *   *      *                                   

A0A8C5YJP3_BCL2A1-      -----------------tgaaacc-----------atacttggacaattt
A0A8C5YLY6_BCL2L1-      gcgatgagggaggcaggcgacaactttgaagggcggtaccggcaggcatt
A0A8C5YTS1_BCL2-01      ----------aggccggcgatgacttctctcgtcgctatcgtcgcgactt
A0A8C6EVC2_BCL2L10      ----------------------ccctctaccgcgggcacccaggtaaccg
                                               *             *            

A0A8C5YJP3_BCL2A1-      tgatgtggtgtctgctgatactgcc-----------------------ag
A0A8C5YLY6_BCL2L1-      ccatgacctgacagcaga----gctccgcctcaccccggagacagcacat
A0A8C5YTS1_BCL2-01      cgccgagat----gtccagtcagctgcacctgacccccttcaccgca-ag
A0A8C6EVC2_BCL2L10      tgtcgagctgatggcacagatggcagaggctg---ttctttccgaca-ac
                            *   *    *   *    **                        * 

A0A8C5YJP3_BCL2A1-      aacaatattcaatcaagtgatggaaaaggaatttgaagatggcatcatga
A0A8C5YLY6_BCL2L1-      cacacttttgaaca-ggtagtggacgaactcttccgggatga---ggtaa
A0A8C5YTS1_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatgg---ggtga
A0A8C6EVC2_BCL2L10      caggccctcaactggggccgtg----------------------------
                               *        *   **                            

A0A8C5YJP3_BCL2A1-      actggggaaggattgtgaccatatttgccttcggaggagttctggtcaag
A0A8C5YLY6_BCL2L1-      gctggggtcgcattgtggcctttttcttctttggaggagcactgtgcttg
A0A8C5YTS1_BCL2-01      actgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
A0A8C6EVC2_BCL2L10      ---tggtgatgcttgtgaccttc----------gcagggacgctgctgga
                            **      ***** ** *           *  * *           

A0A8C5YJP3_BCL2A1-      aaacttct-------------------------gcgagagcggattgccc
A0A8C5YLY6_BCL2L1-      gaaagcat----------------------agacaagga-gatgaaggtg
A0A8C5YTS1_BCL2-01      gagagcgt----------------------caaccggga-gatgtcgccc
A0A8C6EVC2_BCL2L10      gagaaagcctcaggacacccacgggccgcacacccgggaccaagctgccc
                         *                                   **       *   

A0A8C5YJP3_BCL2A1-      ctgctgtggattccgacgtggagatctcttactttgtgg----ctgagtt
A0A8C5YLY6_BCL2L1-      ttggtgtg-----tcagatc----------gcaagttggatgaccactta
A0A8C5YTS1_BCL2-01      ctggtgga-----caacatc----------gccctgtggatgactgagta
A0A8C6EVC2_BCL2L10      tggactgt-----cagcgtctcgtggacttgctctgtg-----ctcagct
                          *               *            *    **     *      

A0A8C5YJP3_BCL2A1-      cattatgaataatgcaggagaatggataaggcaaaatggaggctgggaaa
A0A8C5YLY6_BCL2L1-      cctgaatgatcacctagatacttggatccaggaccacggcggctggg---
A0A8C5YTS1_BCL2-01      cctgaaccggcacctgcacacctggatccaggataacggaggctggg---
A0A8C6EVC2_BCL2L10      cgtggggcggcac---cgcgcctggctggaggctcaaggcggctggg---
                        * *        *          *** *   *    * ** *******   

A0A8C5YJP3_BCL2A1-      atggctttgtaaagaagtttgaacctaaat--------------------
A0A8C5YLY6_BCL2L1-      acactttt------------------------------------------
A0A8C5YTS1_BCL2-01      atgcctttgtggagctgtatggccccagcgtgcggcccctgtacgac---
A0A8C6EVC2_BCL2L10      atggcttt----------------------tgtgacttctttaggacacc
                        *    ***                                          

A0A8C5YJP3_BCL2A1-      -------ctggctggtt-----gacttttctgg----gagttacagggca
A0A8C5YLY6_BCL2L1-      -------ctggc-------------------------------------t
A0A8C5YTS1_BCL2-01      --ttctcctggctgtctctgaagactctgctcagcctggccctggtgg-g
A0A8C6EVC2_BCL2L10      cttgccactaac-gttttggagaaatcttctggtccagatttttatgtcg
                               **  *                                      

A0A8C5YJP3_BCL2A1-      gatctgtgagatgctgtct-------ctcctgaagc---aatactattga
A0A8C5YLY6_BCL2L1-      tgtct---------------------tatctga-----------------
A0A8C5YTS1_BCL2-01      agcct----gcatcaccctgggtgcctacctgggccacaagtga------
A0A8C6EVC2_BCL2L10      tgccttttagcaactatcttcatctatttctg-----caaacgattttaa
                           **                        ***                  

© 1998-2023Legal notice