Dataset for CDS BCL-2-like of organism Marmota marmota marmota

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5YJP3_BCL2A1-      atga----------------------------atgactgtgagttcaggt
A0A8C5YLY6_BCL2L1-      atag-------agagttgtggtaggacaggaaggaacctggaactagtga
A0A8C6ACA1_BCL2L1-      at----------------------gtctcagagcaaccgggagctggtgg
A0A8C6ACA1_BCL2L1-      at----------------------gtctcagagcaaccgggagctggtgg
A0A8C6EVC2_BCL2L10      atggcagacctgctgcaggagcgcaccgcc----------gagctgctga
A0A8C5YTS1_BCL2-01      atgg----ctcacgctgggagaacagggtatgataaccgggagatagtga
A0A8C6EU42_BCL2L2-      atggcgaccccagcct-------cggccccagacacacgggctctggtgg
A0A8C6EU42_BCL2L2-      atggcgaccccagcct-------cggccccagacacacgggctctggtgg
                        **                                      *   *   * 

A0A8C5YJP3_BCL2A1-      tca---------tccacatgctggctcagga---ctacctgcagca----
A0A8C5YLY6_BCL2L1-      tggactttctgtcctacaagctttcccagaaaggataccgctggagccag
A0A8C6ACA1_BCL2L1-      ttgactttctctcctacaagctttcccagaaaggatacagctggagtcag
A0A8C6ACA1_BCL2L1-      ttgactttctctcctacaagctttcccagaaaggatacagctggagtcag
A0A8C6EVC2_BCL2L10      ccgactac------------------ctggagtactgtgcccgg------
A0A8C5YTS1_BCL2-01      tgaagtacatccactataagctgtcacagaggggctacgagtgg------
A0A8C6EU42_BCL2L2-      ccgactttgtaggctataagctgaggcagaagggttatgtctgt------
A0A8C6EU42_BCL2L2-      ccgactttgtaggctataagctgaggcagaagggttatgtctgt------
                                                  * *      *              

A0A8C5YJP3_BCL2A1-      ------cgtcctgcaggta------------ccgcaacgtgggtcaagtc
A0A8C5YLY6_BCL2L1-      tttagccgtgaggaagagaaccgcgttcaagccccagaaagggctgaatc
A0A8C6ACA1_BCL2L1-      tttagcgatgtggaagagaacaggactgaagccccagaagggactgaatc
A0A8C6ACA1_BCL2L1-      tttagcgatgtggaagagaacaggactgaagccccagaagggactgaatc
A0A8C6EVC2_BCL2L10      ------gagccggg---------------------------cacc---cc
A0A8C5YTS1_BCL2-01      ------gatgctggagacgtgggcgctgcgtccccaggagccgcc---cc
A0A8C6EU42_BCL2L2-      ------ggagctgg------------------------------c---cc
A0A8C6EU42_BCL2L2-      ------ggagctgg------------------------------c---cc
                                    *                                    *

A0A8C5YJP3_BCL2A1-      ccaacaaaacgtccaaagtgttacaaaacg----------tggctttct-
A0A8C5YLY6_BCL2L1-      agaagaggggcccagcaatgccaccagcggcaacccatcccggcatcagg
A0A8C6ACA1_BCL2L1-      agaggtggagacccccagtgccatcaatggcaacccatcctggcatctgg
A0A8C6ACA1_BCL2L1-      agaggtggagacccccagtgccatcaatggcaacccatcctggcatctgg
A0A8C6EVC2_BCL2L10      cgag------------------------------------ccgccgccg-
A0A8C5YTS1_BCL2-01      cgggccgggcatcttctcttcc--caaccgggnnnnnnnccggccgccag
A0A8C6EU42_BCL2L2-      tggggagggc-----------------------------ccagcagctga
A0A8C6EU42_BCL2L2-      tggggagggc-----------------------------ccagcagctga
                                                                  **      

A0A8C5YJP3_BCL2A1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      gggacagtcccatggtgagtggagccgctggccataacaggagtttggat
A0A8C6ACA1_BCL2L1-      cggacagccctgcggtaaatggagccactggtcacagcagcagtttggat
A0A8C6ACA1_BCL2L1-      cggacagccctgcggtaaatggagccactggtcacagcagcagtttggat
A0A8C6EVC2_BCL2L10      -------------------t----ccactccc---------------gag
A0A8C5YTS1_BCL2-01      gacctcgcccccccggcccc----ccgctgcc---------------gcc
A0A8C6EU42_BCL2L2-      -------------------t----ccactg--------------------
A0A8C6EU42_BCL2L2-      -------------------t----ccactg--------------------
                                                                          

A0A8C5YJP3_BCL2A1-      -------------------------------------------cagtcca
A0A8C5YLY6_BCL2L1-      gcccccgacgtggtccccatggtagcagtg------aagcaagcgatgag
A0A8C6ACA1_BCL2L1-      gcccgggaggtgatccccatggcagcagtg------aagcaagcattgag
A0A8C6ACA1_BCL2L1-      gcccgggaggtgatccccatggcagcagtg------aagcaagcattgag
A0A8C6EVC2_BCL2L10      gc----------------------------------cgccctgc--tgcg
A0A8C5YTS1_BCL2-01      gcggggcccgtgctcagcccggtgccacctgtggtccacctgaccctccg
A0A8C6EU42_BCL2L2-      ------------------------------------caccaagccatgcg
A0A8C6EU42_BCL2L2-      ------------------------------------caccaagccatgcg
                                                                   *  *   

A0A8C5YJP3_BCL2A1-      aaaagaagttgaaaagaatctgaaaccatacttggacaattttgatgtgg
A0A8C5YLY6_BCL2L1-      ggaggcaggcgacaactttgaagggcggtaccggcaggcattccatgacc
A0A8C6ACA1_BCL2L1-      ggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtgacc
A0A8C6ACA1_BCL2L1-      ggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtgacc
A0A8C6EVC2_BCL2L10      ctccgcggccgcccggttacaacagcaatacgagcccttcttctcc----
A0A8C5YTS1_BCL2-01      ccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccgaga
A0A8C6EU42_BCL2L2-      ggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatc
A0A8C6EU42_BCL2L2-      ggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatc
                            *  *  *              *  *           **        

A0A8C5YJP3_BCL2A1-      tgtctgctga---------tactgccagaacaata---------ttcaat
A0A8C5YLY6_BCL2L1-      tgacagcagagctccgcctcaccccggagacagcacatcacacttttgaa
A0A8C6ACA1_BCL2L1-      tgacgtcccagctccacatcaccccggggacagcatatcagagctttgaa
A0A8C6ACA1_BCL2L1-      tgacgtcccagctccacatcaccccggggacagcatatcagagctttgaa
A0A8C6EVC2_BCL2L10      ------ctctaccgcgggc-acccaggtaaccgtgtcgagctgatg-gca
A0A8C5YTS1_BCL2-01      tgtccagtcagctgcacctgacccccttcaccgcaaggggacgctttgcc
A0A8C6EU42_BCL2L2-      tggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
A0A8C6EU42_BCL2L2-      tggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
                                            **        *             *     

A0A8C5YJP3_BCL2A1-      caagtgatggaaaaggaatt------tgaagatggcatcatgaactgggg
A0A8C5YLY6_BCL2L1-      caggtagtggacgaactctt------ccgggatgaggta---agctgggg
A0A8C6ACA1_BCL2L1-      caggtagtgaacgaactctt------ccgggatggggta---aactgggg
A0A8C6ACA1_BCL2L1-      caggtagtgaacgaactctt------ccgggatggggta---aactgggg
A0A8C6EVC2_BCL2L10      cagatggcagaggctgttctttccgacaaccaggccctc---aactgggg
A0A8C5YTS1_BCL2-01      acggtggtggaggagctctt------cagggatggggtg---aactgggg
A0A8C6EU42_BCL2L2-      caggtctctgacgaactttt------ccaagggggtccc---aactgggg
A0A8C6EU42_BCL2L2-      caggtctctgacgaactttt------ccaagggggtccc---aactgggg
                            *     *        *             *        * ******

A0A8C5YJP3_BCL2A1-      aaggattgtgaccatatttgccttcggaggagttctggt---caagaaac
A0A8C5YLY6_BCL2L1-      tcgcattgtggcctttttcttctttggaggagcactg-tgcttggaaagc
A0A8C6ACA1_BCL2L1-      tcgcattgtggcctttttctccttcggcggggcactg-tgcgtggaaagc
A0A8C6ACA1_BCL2L1-      tcgcattgtggcctttttctccttcggcggggcactg-tgcgtggaaagc
A0A8C6EVC2_BCL2L10      ccgtgtggtgatgcttgtgaccttcgcagggacgctgctggagagaaagc
A0A8C5YTS1_BCL2-01      gaggattgtggccttctttgagttcggtggggtcatg-tgtgtggagagc
A0A8C6EU42_BCL2L2-      tcgtcttgtggccttctttgtctttggggctgccctg-tgtgctgagagt
A0A8C6EU42_BCL2L2-      tcgtcttgtggccttctttgtctttggggctgccctg-tgtgctgagagt
                          *  * ***    *  *    ** *  *      ** *        *  

A0A8C5YJP3_BCL2A1-      ttct----gcgagagcggattgcccctgctgtg---gattccgacgtgga
A0A8C5YLY6_BCL2L1-      atag----acaaggagatgaaggtgttggtgtgtcagatcgcaagttgga
A0A8C6ACA1_BCL2L1-      gtag----acaaggagatgcaggtattggtgagtcggatcgcaagttgga
A0A8C6ACA1_BCL2L1-      gtag----acaaggagatgcaggtattggtgagtcggatcgcaagttgga
A0A8C6EVC2_BCL2L10      ctcaggacacccacgggccgcacacccg--ggaccaagctgccctg-gac
A0A8C5YTS1_BCL2-01      gtca----accgggagatgtcgcccctggtggacaacatcgccctgtgga
A0A8C6EU42_BCL2L2-      gtca----acaaagagatggagccactggtgggacaagtgcaggagtgga
A0A8C6EU42_BCL2L2-      gtca----acaaagagatggagccactggtgggacaagtgcaggagtgga
                         *       *                 *  *                *  

A0A8C5YJP3_BCL2A1-      gatctcttactttgtggctgagt----------------------tcatt
A0A8C5YLY6_BCL2L1-      --------------tgaccactt----------------------acctg
A0A8C6ACA1_BCL2L1-      --------------tggccactt----------------------acctg
A0A8C6ACA1_BCL2L1-      --------------tggccactt----------------------acctg
A0A8C6EVC2_BCL2L10      --------------tgtcagcgtctcgtggacttgctctgtgctcagctc
A0A8C5YTS1_BCL2-01      --------------tgactgagt----------------------acctg
A0A8C6EU42_BCL2L2-      --------------tggtggcct----------------------acctg
A0A8C6EU42_BCL2L2-      --------------tggtggcct----------------------acctg
                                      **      *                         * 

A0A8C5YJP3_BCL2A1-      atgaataatgcaggagaatggataaggcaaaatggaggctgggaaaatgg
A0A8C5YLY6_BCL2L1-      aatgatcacctagatacttggatccaggaccacggcggctggg---acac
A0A8C6ACA1_BCL2L1-      aatgaccacctagagccttggatccaggagaacggcggctggg---acac
A0A8C6ACA1_BCL2L1-      aatgaccacctagagccttggatccaggagaacggcggctggg---acac
A0A8C6EVC2_BCL2L10      gtggggcggcaccgcgcctggctggaggctcaaggcggctggg---atgg
A0A8C5YTS1_BCL2-01      aaccggcacctgcacacctggatccaggataacggaggctggg---atgc
A0A8C6EU42_BCL2L2-      gagacgcggctggctgactggatccacagcagtgggggctggg---cgga
A0A8C6EU42_BCL2L2-      gagacgcggctggctgactggatccacagcagtgggggctggg---cgga
                                          *** *          ** *******       

A0A8C5YJP3_BCL2A1-      ctttgtaaagaagtttgaacctaaatct-----ggctggttgacttttct
A0A8C5YLY6_BCL2L1-      tttt----------------------------------------------
A0A8C6ACA1_BCL2L1-      ttttgtggaactctacgggaataacgcggcagcagagagccggaagggcc
A0A8C6ACA1_BCL2L1-      ttttgtggaactctacgggaataacgcggcagcagagagccggaagggcc
A0A8C6EVC2_BCL2L10      cttt----------------------------------tgtgacttcttt
A0A8C5YTS1_BCL2-01      ctttgtggagctgtat--------ggccccagc----gtgcggcccctgt
A0A8C6EU42_BCL2L2-      gttcacagctctatacggggacggggccctggaggaggcacggcgtctgc
A0A8C6EU42_BCL2L2-      gttcacagctctatacggggacggggccctggaggaggcacggcgtctgc
                         **                                               

A0A8C5YJP3_BCL2A1-      gggag---------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8C6ACA1_BCL2L1-      aggag--cgcttcaaccgttggttcctga---------------cgggca
A0A8C6ACA1_BCL2L1-      aggag--cgcttcaaccgttggttcctga---------------cgggca
A0A8C6EVC2_BCL2L10      aggacacccttgccactaa-cgttttggagaaatcttctggtccagattt
A0A8C5YTS1_BCL2-01      acgac-----ttctcctggctgtctctgaagactctgctcagcctggccc
A0A8C6EU42_BCL2L2-      gggag-----gggaactgggcatcagtgaggacagtgctgacgggggccg
A0A8C6EU42_BCL2L2-      gggag-----gggaactgggcatcagtgaggacagtgctgacgggggccg
                                                                          

A0A8C5YJP3_BCL2A1-      ttacagggcagatctgtgagatgctgtctctcctgaagcaatactattga
A0A8C5YLY6_BCL2L1-      -----------------------ctggcttgtcttatc---------tga
A0A8C6ACA1_BCL2L1-      tgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
A0A8C6ACA1_BCL2L1-      tgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
A0A8C6EVC2_BCL2L10      ttatgtcgtgccttttagcaactatcttcatctattt---ctgcaaacga
A0A8C5YTS1_BCL2-01      tgg---tgggagcctgcatcaccctgggtgcctacctgggccacaagtga
A0A8C6EU42_BCL2L2-      tggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
A0A8C6EU42_BCL2L2-      tggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
                                                *                       **

A0A8C5YJP3_BCL2A1-      ------
A0A8C5YLY6_BCL2L1-      ------
A0A8C6ACA1_BCL2L1-      ------
A0A8C6ACA1_BCL2L1-      ------
A0A8C6EVC2_BCL2L10      ttttaa
A0A8C5YTS1_BCL2-01      ------
A0A8C6EU42_BCL2L2-      ------
A0A8C6EU42_BCL2L2-      ------
                              

© 1998-2022Legal notice