Dataset for CDS BCL2A1 of organism Oryctolagus cuniculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=852 residues).
atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagcagaagatgagtga
ctgcgagtttggctatgtgcacacactggctcaggactatctgctgtacatcctgaagacgccacagcctggactgggac
cgagcaaaacgtccagggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggctctgcaaccgtacctg
cacaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaagagtttgaggatggtgt
gatcaactggggcaggattgtgaccatatttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
cggatgtggacacgttcaagtccatcccttattttgtggctgagttcataacgaggaggatgggagaatggataaggcaa
aacggaggctgggtgattgcccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgccggatgaaat
cgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgctttatcccccgctaccggttgcagagcaatc
acatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcctggaacattcatcagccgagt
gagagtgacacgcgggaggaggccttggccaccgatgcacacatgcagatgagcagagaaggctatggaagagaagaacc
cagcgcacagggaaggctgttctctctggagggcggtaggcagaaatgttaa
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=567 residues).
atggcggcggcggcggctgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggccatcagcgc
cgaggagcgactgcgccagtcccgcctactgacccagaaggtgattgcccaccggcagtatcagaaatcccagagaatct
ccatcttcctgagcatgccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgcttt
atcccccgctaccggttgcagagcaatcacatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaa
aacctcctggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatct
tcatgccgggcctcgggctttgccccctgctgctgcttttgctactccgacatccgttcttcgcttgctgctcaggtgcg
gagtttacgcttcctcttcttgctctcggaacgccagcatggtctggagaccagcggctgatactcctaagagcttctct
ttgttga
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=996 residues).
atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagcagaagatgagtga
ctgcgagtttggctatgtgcacacactggctcaggactatctgctgtacatcctgaagacgccacagcctggactgggac
cgagcaaaacgtccagggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggctctgcaaccgtacctg
cacaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaagagtttgaggatggtgt
gatcaactggggcaggattgtgaccatatttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
cggatgtggacacgttcaagtccatcccttattttgtggctgagttcataacgaggaggatgggagaatggataaggcaa
aacggaggctgggtgattgcccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgccggatgaaat
cgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgctttatcccccgctaccggttgcagagcaatc
acatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcctggaacattcatcagccgagt
gagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggga
cggcaaccggctggggaggggcaggggctactacgacacctacctgcagcgctgcctgcagcagcagggggcaaagccct
acaccatcgccctggccttcagagagcagatctgcccccaggtgcccgtggacgacacagacatgagcgtcgacgaggtg
ctgtacgtggacgcggccgcttccctcgcgccctga
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=624 residues).
atggcggcggcggcggctgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggccatcagcgc
cgaggagcgactgcgccagtcccgcctactgacccagaaggtgattgcccaccggcagtatcagaaatcccagagaatct
ccatcttcctgagcatgccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgcttt
atcccccgctaccggttgcagagcaatcacatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaa
aacctcctggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatct
tcatgccgggcctcgggttcgacagggacggcaaccggctggggaggggcaggggctactacgacacctacctgcagcgc
tgcctgcagcagcagggggcaaagccctacaccatcgccctggccttcagagagcagatctgcccccaggtgcccgtgga
cgacacagacatgagcgtcgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
© 1998-2020Legal notice