Dataset for CDS BCL2A1 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F9CXI7_BCL2A1-      atg-----------------------------------------------
A0A5F9CXI7_BCL2A1-      atg-----------------------------------------------
A0A5F9CXI7_BCL2A1-      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
A0A5F9CXI7_BCL2A1-      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
                        ***                                               

A0A5F9CXI7_BCL2A1-      --------------------------gcggcggcgg---cggctgtgagc
A0A5F9CXI7_BCL2A1-      --------------------------gcggcggcgg---cggctgtgagc
A0A5F9CXI7_BCL2A1-      tctgctctccgagcagcagaagatgagtgactgcgagtttggctatgtgc
A0A5F9CXI7_BCL2A1-      tctgctctccgagcagcagaagatgagtgactgcgagtttggctatgtgc
                                                  * * * ***     **** ** **

A0A5F9CXI7_BCL2A1-      -------------------------------------ggcgcca-agcgg
A0A5F9CXI7_BCL2A1-      -------------------------------------ggcgcca-agcgg
A0A5F9CXI7_BCL2A1-      acacactggctcaggactatctgctgtacatcctgaagacgccacagcct
A0A5F9CXI7_BCL2A1-      acacactggctcaggactatctgctgtacatcctgaagacgccacagcct
                                                             * ***** ***  

A0A5F9CXI7_BCL2A1-      agcctgcgggccgagctgaa---gcagcgt-ctgcgggccatcagcgc--
A0A5F9CXI7_BCL2A1-      agcctgcgggccgagctgaa---gcagcgt-ctgcgggccatcagcgc--
A0A5F9CXI7_BCL2A1-      ggactg-ggaccgagcaaaacgtccagggtgctgcagaacgtcaccttct
A0A5F9CXI7_BCL2A1-      ggactg-ggaccgagcaaaacgtccagggtgctgcagaacgtcaccttct
                         * *** ** ******  **    *** ** **** *  * *** *    

A0A5F9CXI7_BCL2A1-      --------cgaggagcg---------------------------actgcg
A0A5F9CXI7_BCL2A1-      --------cgaggagcg---------------------------actgcg
A0A5F9CXI7_BCL2A1-      ccatccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtg
A0A5F9CXI7_BCL2A1-      ccatccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtg
                                * ** ** *                           * ** *

A0A5F9CXI7_BCL2A1-      ccagtcccgcc---------------------------------------
A0A5F9CXI7_BCL2A1-      ccagtcccgcc---------------------------------------
A0A5F9CXI7_BCL2A1-      cctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatgga
A0A5F9CXI7_BCL2A1-      cctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatgga
                        ** *** ** *                                       

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gaaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatat
A0A5F9CXI7_BCL2A1-      gaaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatat
                                                                          

A0A5F9CXI7_BCL2A1-      ---------------tactgacccagaa----------------------
A0A5F9CXI7_BCL2A1-      ---------------tactgacccagaa----------------------
A0A5F9CXI7_BCL2A1-      ttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgtt
A0A5F9CXI7_BCL2A1-      ttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgtt
                                       * *** ** ****                      

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ccggatgtggacacgttcaagtccatcccttattttgtggctgagttcat
A0A5F9CXI7_BCL2A1-      ccggatgtggacacgttcaagtccatcccttattttgtggctgagttcat
                                                                          

A0A5F9CXI7_BCL2A1-      ------------------------------------------ggtgattg
A0A5F9CXI7_BCL2A1-      ------------------------------------------ggtgattg
A0A5F9CXI7_BCL2A1-      aacgaggaggatgggagaatggataaggcaaaacggaggctgggtgattg
A0A5F9CXI7_BCL2A1-      aacgaggaggatgggagaatggataaggcaaaacggaggctgggtgattg
                                                                  ********

A0A5F9CXI7_BCL2A1-      cccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatg
A0A5F9CXI7_BCL2A1-      cccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatg
A0A5F9CXI7_BCL2A1-      cccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatg
A0A5F9CXI7_BCL2A1-      cccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatg
                        **************************************************

A0A5F9CXI7_BCL2A1-      ccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaagg
A0A5F9CXI7_BCL2A1-      ccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaagg
A0A5F9CXI7_BCL2A1-      ccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaagg
A0A5F9CXI7_BCL2A1-      ccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaagg
                        **************************************************

A0A5F9CXI7_BCL2A1-      caaagtctgctttatcccccgctaccggttgcagagcaatcacatggata
A0A5F9CXI7_BCL2A1-      caaagtctgctttatcccccgctaccggttgcagagcaatcacatggata
A0A5F9CXI7_BCL2A1-      caaagtctgctttatcccccgctaccggttgcagagcaatcacatggata
A0A5F9CXI7_BCL2A1-      caaagtctgctttatcccccgctaccggttgcagagcaatcacatggata
                        **************************************************

A0A5F9CXI7_BCL2A1-      tggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcc
A0A5F9CXI7_BCL2A1-      tggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcc
A0A5F9CXI7_BCL2A1-      tggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcc
A0A5F9CXI7_BCL2A1-      tggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcc
                        **************************************************

A0A5F9CXI7_BCL2A1-      tggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggc
A0A5F9CXI7_BCL2A1-      tggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggc
A0A5F9CXI7_BCL2A1-      tggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggc
A0A5F9CXI7_BCL2A1-      tggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggc
                        **************************************************

A0A5F9CXI7_BCL2A1-      caccgggggcctcgacctcatcttcatgccgggcctcgggct--------
A0A5F9CXI7_BCL2A1-      caccgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggg
A0A5F9CXI7_BCL2A1-      caccgatg--------caca----catgcaga---------tgagcagag
A0A5F9CXI7_BCL2A1-      caccgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggg
                        *****  *        * **    ***** *          *        

A0A5F9CXI7_BCL2A1-      -ttgccccctgctgct-----gcttttgctactccgacatccgtt--ctt
A0A5F9CXI7_BCL2A1-      acggcaaccggctggggaggggcaggggctactacgacacctacctgcag
A0A5F9CXI7_BCL2A1-      a-------aggctatggaagagaagaacc------------------cag
A0A5F9CXI7_BCL2A1-      acggcaaccggctggggaggggcaggggctactacgacacctacctgcag
                                  ***        *      *                  *  

A0A5F9CXI7_BCL2A1-      cgcttgctgc----tcaggtgcggagtttacgcttcctcttcttgctctc
A0A5F9CXI7_BCL2A1-      cgctgcctgcagcagcagggggcaaagccctacaccatcgccctggcctt
A0A5F9CXI7_BCL2A1-      cgc-----------acaggg---aaggctgttc-------------tctc
A0A5F9CXI7_BCL2A1-      cgctgcctgcagcagcagggggcaaagccctacaccatcgccctggcctt
                        ***            ****     *       *              ** 

A0A5F9CXI7_BCL2A1-      ggaacgccagcatggtc------------tggagaccagcggctgatact
A0A5F9CXI7_BCL2A1-      cagagagcagatctgcccccaggtgcccgtggacgacacagacatgagcg
A0A5F9CXI7_BCL2A1-      tggagggcgg----------------------------taggcagaaatg
A0A5F9CXI7_BCL2A1-      cagagagcagatctgcccccaggtgcccgtggacgacacagacatgagcg
                           *   * *                              * *       

A0A5F9CXI7_BCL2A1-      cctaagagcttctctttgttga-------------------------
A0A5F9CXI7_BCL2A1-      tcgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
A0A5F9CXI7_BCL2A1-      ttaa-------------------------------------------
A0A5F9CXI7_BCL2A1-      tcgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
                           *                                           

© 1998-2020Legal notice