Dataset for CDS BCL2A1 of organism Oryctolagus cuniculus

[Download (right click)] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A5F9CXI7_BCL2A1-01      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
A0A5F9CXI7_BCL2A1-03      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
A0A5F9CXI7_BCL2A1-04      atggcggcggcggcggctgtgagcggcgccaagcggag------------
A0A5F9CXI7_BCL2A1-02      atggcggcggcggcggctgtgagcggcgccaagcggag------------
                          ***   **  *   **   *  *  **  * **  **             

A0A5F9CXI7_BCL2A1-01      tctgctctccgagcagcagaagatgagtgactgcgagtttggctatgtgc
A0A5F9CXI7_BCL2A1-03      tctgctctccgagcagcagaagatgagtgactgcgagtttggctatgtgc
A0A5F9CXI7_BCL2A1-04      cctgcgggccgagctgaagca-----------------------------
A0A5F9CXI7_BCL2A1-02      cctgcgggccgagctgaagca-----------------------------
                           ****   ****** * ** *                             

A0A5F9CXI7_BCL2A1-01      acacactggctcaggactatctgctgtacatcctgaagacgccacagcct
A0A5F9CXI7_BCL2A1-03      acacactggctcaggactatctgctgtacatcctgaagacgccacagcct
A0A5F9CXI7_BCL2A1-04      ----------------------------------------gcgtctgcgg
A0A5F9CXI7_BCL2A1-02      ----------------------------------------gcgtctgcgg
                                                                  **  * **  

A0A5F9CXI7_BCL2A1-01      ggactgggaccgagcaaaacgtccagggtgctgcagaacgtcaccttctc
A0A5F9CXI7_BCL2A1-03      ggactgggaccgagcaaaacgtccagggtgctgcagaacgtcaccttctc
A0A5F9CXI7_BCL2A1-04      gcc------------------------------------atcag------
A0A5F9CXI7_BCL2A1-02      gcc------------------------------------atcag------
                          *                                       ***       

A0A5F9CXI7_BCL2A1-01      catccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtgc
A0A5F9CXI7_BCL2A1-03      catccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtgc
A0A5F9CXI7_BCL2A1-04      ------------cgccgaggagcgactgcgcc------------------
A0A5F9CXI7_BCL2A1-02      ------------cgccgaggagcgactgcgcc------------------
                                       *  ** ***   ****  *                  

A0A5F9CXI7_BCL2A1-01      ctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggag
A0A5F9CXI7_BCL2A1-03      ctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggag
A0A5F9CXI7_BCL2A1-04      --------------------------------------------------
A0A5F9CXI7_BCL2A1-02      --------------------------------------------------
                                                                            

A0A5F9CXI7_BCL2A1-01      aaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatatt
A0A5F9CXI7_BCL2A1-03      aaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatatt
A0A5F9CXI7_BCL2A1-04      --------------------------------------------------
A0A5F9CXI7_BCL2A1-02      --------------------------------------------------
                                                                            

A0A5F9CXI7_BCL2A1-01      tgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
A0A5F9CXI7_BCL2A1-03      tgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
A0A5F9CXI7_BCL2A1-04      -----------------------agtcccgcctactgacc----------
A0A5F9CXI7_BCL2A1-02      -----------------------agtcccgcctactgacc----------
                                                 **   * *** * *             

A0A5F9CXI7_BCL2A1-01      cggatgtggacacgttcaagtccatcccttattttgtggctgagttcata
A0A5F9CXI7_BCL2A1-03      cggatgtggacacgttcaagtccatcccttattttgtggctgagttcata
A0A5F9CXI7_BCL2A1-04      --------------------------------------------------
A0A5F9CXI7_BCL2A1-02      --------------------------------------------------
                                                                            

A0A5F9CXI7_BCL2A1-01      acgaggaggatgggagaatggataaggcaaaacggaggctgggtgattgc
A0A5F9CXI7_BCL2A1-03      acgaggaggatgggagaatggataaggcaaaacggaggctgggtgattgc
A0A5F9CXI7_BCL2A1-04      ------------------------------------cagaaggtgattgc
A0A5F9CXI7_BCL2A1-02      ------------------------------------cagaaggtgattgc
                                                                   *********

A0A5F9CXI7_BCL2A1-01      ccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgc
A0A5F9CXI7_BCL2A1-03      ccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgc
A0A5F9CXI7_BCL2A1-04      ccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgc
A0A5F9CXI7_BCL2A1-02      ccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgc
                          **************************************************

A0A5F9CXI7_BCL2A1-01      cggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggc
A0A5F9CXI7_BCL2A1-03      cggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggc
A0A5F9CXI7_BCL2A1-04      cggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggc
A0A5F9CXI7_BCL2A1-02      cggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggc
                          **************************************************

A0A5F9CXI7_BCL2A1-01      aaagtctgctttatcccccgctaccggttgcagagcaatcacatggatat
A0A5F9CXI7_BCL2A1-03      aaagtctgctttatcccccgctaccggttgcagagcaatcacatggatat
A0A5F9CXI7_BCL2A1-04      aaagtctgctttatcccccgctaccggttgcagagcaatcacatggatat
A0A5F9CXI7_BCL2A1-02      aaagtctgctttatcccccgctaccggttgcagagcaatcacatggatat
                          **************************************************

A0A5F9CXI7_BCL2A1-01      ggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcct
A0A5F9CXI7_BCL2A1-03      ggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcct
A0A5F9CXI7_BCL2A1-04      ggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcct
A0A5F9CXI7_BCL2A1-02      ggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcct
                          **************************************************

A0A5F9CXI7_BCL2A1-01      ggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggcc
A0A5F9CXI7_BCL2A1-03      ggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggcc
A0A5F9CXI7_BCL2A1-04      ggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggcc
A0A5F9CXI7_BCL2A1-02      ggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggcc
                          **************************************************

A0A5F9CXI7_BCL2A1-01      accgatgcacacatgcagatgagcaga-----------------------
A0A5F9CXI7_BCL2A1-03      accgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggga
A0A5F9CXI7_BCL2A1-04      accgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggga
A0A5F9CXI7_BCL2A1-02      accgggggcctcgacctcatcttcatgccgggcctcgggctttgccc---
                          ****  *  * *   *  **   **                         

A0A5F9CXI7_BCL2A1-01      --------------------------------------------------
A0A5F9CXI7_BCL2A1-03      cggcaaccggctggggaggggcaggggctactacgacacctacctgcagc
A0A5F9CXI7_BCL2A1-04      cggcaaccggctggggaggggcaggggctactacgacacctacctgcagc
A0A5F9CXI7_BCL2A1-02      -----------cctgctgctgcttttgctactccgacat--ccgttcttc
                                                                            

A0A5F9CXI7_BCL2A1-01      --------------------------------------------------
A0A5F9CXI7_BCL2A1-03      gctgcctgcagcagcagggggcaaagccctacaccatcgccctggccttc
A0A5F9CXI7_BCL2A1-04      gctgcctgcagcagcagggggcaaagccctacaccatcgccctggccttc
A0A5F9CXI7_BCL2A1-02      gcttgctgctcaggtgcggagttta-cgcttcctcttcttg----ctctc
                                                                            

A0A5F9CXI7_BCL2A1-01      --------------------gaaggctatggaagaga-agaacccagcgc
A0A5F9CXI7_BCL2A1-03      agagagcagatctgcccccaggtgcccgtggacgacacagacatgagcgt
A0A5F9CXI7_BCL2A1-04      agagagcagatctgcccccaggtgcccgtggacgacacagacatgagcgt
A0A5F9CXI7_BCL2A1-02      ggaacgccagcatgg-tctggagaccagcggctgatactcctaagagctt
                                              *    *   **  ** *        ***  

A0A5F9CXI7_BCL2A1-01      acagggaaggctgttctctctggagggcggtaggcagaaatgttaa
A0A5F9CXI7_BCL2A1-03      cgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
A0A5F9CXI7_BCL2A1-04      cgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
A0A5F9CXI7_BCL2A1-02      ct----------c-------------------------tttgttga
                                                                     * *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice