Dataset for CDS MCL-1 of organism Scleropages formosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9VMU9_MCL1-01      atgtggacagcgagtagctacaagtgccgcgacgagacgctttctgtgaa
A0A8C9WE28_MCL1-01      --------------------------------------------------
                                                                          

A0A8C9VMU9_MCL1-01      cgggttatacatgtttaataattcattttttccaaaaatgagtcagtcga
A0A8C9WE28_MCL1-01      -------------------------------------atgagtatgtcaa
                                                             ******  *** *

A0A8C9VMU9_MCL1-01      tgatgaagcctcctcacaccagttttatggacatttgctgtccgggaaat
A0A8C9WE28_MCL1-01      cgatgaaccgcgtttccgctgttagtctg------ctctgccccggtgtt
                         ****** *    *  * *   *  * **        *** ** **   *

A0A8C9VMU9_MCL1-01      aaagctcgaggtggaggaacgaactatcaggacggctcagacaaagcgcc
A0A8C9WE28_MCL1-01      aaggccaaagttttcg------acca--aggcccgttc---ccagccgcc
                        ** **   ** *   *      ** *  *** * * **   * *  ****

A0A8C9VMU9_MCL1-01      ccaggtggctctggcctctgaggtg------gaggacgagctgctctacg
A0A8C9WE28_MCL1-01      tcgtccggct----cctccaagctgccgagcgaggaggagctggacgacg
                         *    ****    ****  ** **      ***** ******  * ***

A0A8C9VMU9_MCL1-01      ggctggatgaggtggacagctgcctccgctctcccaaaacggggggaaaa
A0A8C9WE28_MCL1-01      tgtccgatgaggtggac-tccgctccggcccccatcaagt----------
                         *   ************  * **  * ** * *   **            

A0A8C9VMU9_MCL1-01      ggaactccaaaaaagctcgtcttggagaggctcgtcccgaagtcgaggag
A0A8C9WE28_MCL1-01      ----cctccagcaagctctcctt-----------ccccggcggcttccag
                            *  * *  ******  ***            ****  * *    **

A0A8C9VMU9_MCL1-01      cggcggggtcgaggataatggttctctg----------ccttgtact--c
A0A8C9WE28_MCL1-01      cag-agctccaacgcggacggctctctgccaaactcccccccggactcgc
                        * *  *   * * *   * ** ******          **  * ***  *

A0A8C9VMU9_MCL1-01      cgggcaactcgccgacgacggaatgcggacaaatgtgcgagttccacgac
A0A8C9WE28_MCL1-01      cggatagctccccg--gacgcgccgctggccgcc-tgctgcttcc-cga-
                        ***  * *** ***  ****    ** * *     ***   **** *** 

A0A8C9VMU9_MCL1-01      aatcatggcgacgaattgttggagcgggagacgcacgagttgctggggga
A0A8C9WE28_MCL1-01      ----aggctgacgcgcagctcgagcgcgacacccgcgcgctcgtcggcgc
                            * *  ****    * * ***** ** ** * ** * *  * ** * 

A0A8C9VMU9_MCL1-01      tttcctactgctgtacgctgggatgtttcaggggaa----gccgagacgg
A0A8C9WE28_MCL1-01      cttcctgcgctcgttcgcgggcctgagccgcggcgactgcgcccagtcg-
                         ***** *    ** *** **  **   *  **  *    *** ** ** 

A0A8C9VMU9_MCL1-01      agcagagctctgcgcaccatgcagcgcgtcgtggaagatgtgctcctgaa
A0A8C9WE28_MCL1-01      ---cgcgcgctgcccgtgatgcggcgcgtggttgaagagctgctcgagaa
                            * ** **** *   **** ****** ** *****  *****  ***

A0A8C9VMU9_MCL1-01      gcacagatttacatacaaaggtatgatttcaaagcagaggctggagcagg
A0A8C9WE28_MCL1-01      gcatcacctggtgtaccagggtatgattcaaaagctggatgtagaccatc
                        ***     *    *** * *********  ***** *    * ** **  

A0A8C9VMU9_MCL1-01      aaagtgatgacatgggcttcattaaagctgttgcccagaacctcttcagt
A0A8C9WE28_MCL1-01      gagaagatgacactagttttgtcacagctgtggccaagaacctcttcagt
                         *   *******   * **  * * ****** *** **************

A0A8C9VMU9_MCL1-01      gatcaggtgacaaattggggccgcatcgttggcctggtagcgtttggcgc
A0A8C9WE28_MCL1-01      gatggacacaccaactggggccgcatcgccagcctcatcgcgtttggtgc
                        ***      ** ** *************   ****  * ******** **

A0A8C9VMU9_MCL1-01      agaggtgagcaagcacctgaaggagagtgggcgtgagcactgcatcggga
A0A8C9WE28_MCL1-01      tgttgtctgccagcgtctgaaggacagcggcagggagcactgtgt--aga
                         *  **  ** ***  ******** ** **  * ********  *   **

A0A8C9VMU9_MCL1-01      cagttggggca--cagatctctacttacctcctcactgagcaaagagagt
A0A8C9WE28_MCL1-01      cagtgtcgccagtcagatctcctcttacctagtgacagagcaacaagatt
                        ****   * **  ********  *******  * ** ******  *** *

A0A8C9VMU9_MCL1-01      ggctgctcaacaataaggcctgggaaggatttgtggagttcttcaccatt
A0A8C9WE28_MCL1-01      ggttgagcaacaataaaggctgggagggctttgttgacttcttccatatt
                        ** **  ********* * ****** ** ***** ** ******   ***

A0A8C9VMU9_MCL1-01      gaagatgctgagtcggtggtgagaaattcccttcttgcatttgcaaccat
A0A8C9WE28_MCL1-01      gaggacacggagtctctagtgagaaatgcccttatggctttcgcaggggt
                        ** **  * *****  * ********* ***** * ** ** ***    *

A0A8C9VMU9_MCL1-01      ggcgtggatagggctaggaattgcatacttcatgaaatga
A0A8C9WE28_MCL1-01      tgcaggaattggggctggacttgctcttctcatccggtga
                         **  * ** ***   *** ****     ****    ***

© 1998-2023Legal notice