Dataset for CDS MCL-1 of organism Scleropages formosus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9VMU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=966 residues).
atgtggacagcgagtagctacaagtgccgcgacgagacgctttctgtgaacgggttatacatgtttaataattcattttt
tccaaaaatgagtcagtcgatgatgaagcctcctcacaccagttttatggacatttgctgtccgggaaataaagctcgag
gtggaggaacgaactatcaggacggctcagacaaagcgccccaggtggctctggcctctgaggtggaggacgagctgctc
tacgggctggatgaggtggacagctgcctccgctctcccaaaacggggggaaaaggaactccaaaaaagctcgtcttgga
gaggctcgtcccgaagtcgaggagcggcggggtcgaggataatggttctctgccttgtactccgggcaactcgccgacga
cggaatgcggacaaatgtgcgagttccacgacaatcatggcgacgaattgttggagcgggagacgcacgagttgctgggg
gatttcctactgctgtacgctgggatgtttcaggggaagccgagacggagcagagctctgcgcaccatgcagcgcgtcgt
ggaagatgtgctcctgaagcacagatttacatacaaaggtatgatttcaaagcagaggctggagcaggaaagtgatgaca
tgggcttcattaaagctgttgcccagaacctcttcagtgatcaggtgacaaattggggccgcatcgttggcctggtagcg
tttggcgcagaggtgagcaagcacctgaaggagagtgggcgtgagcactgcatcgggacagttggggcacagatctctac
ttacctcctcactgagcaaagagagtggctgctcaacaataaggcctgggaaggatttgtggagttcttcaccattgaag
atgctgagtcggtggtgagaaattcccttcttgcatttgcaaccatggcgtggatagggctaggaattgcatacttcatg
aaatga
>gnl|bcl2dbcds|A0A8C9WE28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=840 residues).
atgagtatgtcaacgatgaaccgcgtttccgctgttagtctgctctgccccggtgttaaggccaaagttttcgaccaagg
cccgttcccagccgcctcgtccggctcctccaagctgccgagcgaggaggagctggacgacgtgtccgatgaggtggact
ccgctccggcccccatcaagtcctccagcaagctctccttccccggcggcttccagcagagctccaacgcggacggctct
ctgccaaactcccccccggactcgccggatagctccccggacgcgccgctggccgcctgctgcttcccgaaggctgacgc
gcagctcgagcgcgacacccgcgcgctcgtcggcgccttcctgcgctcgttcgcgggcctgagccgcggcgactgcgccc
agtcgcgcgcgctgcccgtgatgcggcgcgtggttgaagagctgctcgagaagcatcacctggtgtaccagggtatgatt
caaaagctggatgtagaccatcgagaagatgacactagttttgtcacagctgtggccaagaacctcttcagtgatggaca
caccaactggggccgcatcgccagcctcatcgcgtttggtgctgttgtctgccagcgtctgaaggacagcggcagggagc
actgtgtagacagtgtcgccagtcagatctcctcttacctagtgacagagcaacaagattggttgagcaacaataaaggc
tgggagggctttgttgacttcttccatattgaggacacggagtctctagtgagaaatgcccttatggctttcgcaggggt
tgcaggaattggggctggacttgctcttctcatccggtga
© 1998-2023Legal notice