Dataset for CDS BCL-2-like of organism Peromyscus maniculatus bairdii

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A6I9LMY5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctgtcccagaaagggtacagctggagtcagtt
tagtgatgtcgaagaggacaggactgaggctccagaaggaactgattccgagagggagacccccagtgccgtcaatggca
acccatcctggcgcctggccgacagccccgcggtgaacggagccactggccacagcagcagtttggatgcgcgggaggtg
atccccatggcggcggtgaagcaggcgctgagagaggccggcgatgagtttgaactgcggtatcggcgggccttcagtga
tctaacatcccagcttcatataaccccagggacagcctatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcatcgtggcctttttctccttcggtggagccctgtgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagccgctgagagccgaaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A6I9LUT0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccaggggagggcccagcagctgaccccctgcaccaagccatgcgggctgctggagacgagtttg
agacacgcttccggcgcaccttctccgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgatgaacttttccaagggggccccaactggggccgtcttgtggcattctttgtctttggggctgccttgtg
tgctgaaagtgtcaacaaagaaatggagcccctggtgggacaagtgcaggattggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctgtacggggacggggccctggaggaggcgcgg
cggctgcgggaggggaactgggcatcagtgaggacagtgctgaccggggccgtggccctgggggccctggttactgtcgg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C8U2B9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2A1 (length=513 residues).
atgactgactgtgagttcatgtttatccacgctgaggactatcttcagtatgtcttgcaggtacccactttggaatcggc
tccaagcaaaacatccagagtgctacaaagagttgctttctcagctcaaaaaaaagtggaaaagaatctgaaactatact
tggattattttgatgtgggatccattgatgctgccagaactatcttcaatcaagtgatggaaaaagaatttgaagatggc
atcattaactggggaaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaactcccacaagagcagattga
catggatgcagatgcttacaagcaagtttccagttttgtggctgaattcataatgaataacacaggagaatggatacggc
agaatggaggctgggaagatggcttcatgaagaagtttgaacctaaatctggctggctgacctttctggaaatgacagga
cagatctgggaaatgctctttctcctcaagcaa
>gnl|bcl2dbcds|A0A8C8U7I9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtcatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgcgggagatgccgacgccgcgcccctgggggccgcccccacccctggcatcttctccttccagcccc
agagcaacccaacgcccgctgtgcaccgggacacggctgccaggacgtcaccaccacggcccatagtcgccaccgctgga
cctgcgctcagcccggtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaagaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcctttgtggaactgtatggccccagcgtgcggcctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctagccctggtgggggcctgcatcactctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C8UAX6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L10 (length=582 residues).
gtgagcgacagccagaggatgggtgatccgctgctggaacgcaccagaaggctgctgactgactacttgacgttctgtgc
gcgggagccgggcacccccgagccgccgcccgggtcgaccgaggcggccttgctgcgctctgtggcaggtgaagtccaag
agaactaccaggaattcttctcctccttcctgggctaccagggcaaccgcctggagctggtgacacggatggtggatgtg
gtgctctccgataccatcaactggggccgcctggtgttggtcttgaccttcgcagggacgcttctgaagcaaggcccttg
caaggctaccaagcagaagaggcgtggtcgggggaatcaatcccaagtgacccgagactgccagctcatagtggactttc
tatgcagtcggatcctgggacagcatcgttcctggctggaggctcaggatggctgggatggcttttgcgacttcttcaag
agcccctttccactctgtttttggagactggtgatcaagactcttctgtactgcctcattgcaacagccaccctgtatgt
ctggaaacaatttagattttaa
>gnl|bcl2dbcds|A0A8C8UMK7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=MCL-1 (length=441 residues).
gggggagtgaggagccgggctcctgtggcagccattggacaactctgtggggctggcccgctccttcccccttccggcat
gctccggaagctggacattaaaaacgaagacgatgtgaaatctttttctcgagtgatggtccatgttttcaaagatggcg
taacaaactggggcaggattgtgactcttatttcttttggtgcctatgtggccaaacacttgaagagcataaaccaggag
agctgcatcgaaccattagcagaaagtatcacagatgttcttgtacggacaaaacgggactggcttgtcagacaaagagg
ctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcctttgcgggtg
ttgctggagtaggggctggtctggcatacctaataagatag
© 1998-2023Legal notice