Dataset for CDS BCL2A1 of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8ZJ66_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
A0A2R8ZJ66_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
A0A2R8ZJ66_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct

A0A2R8ZJ66_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagccaaacgt
A0A2R8ZJ66_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagccaaacgt
A0A2R8ZJ66_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagccaaacgt

A0A2R8ZJ66_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag
A0A2R8ZJ66_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag
A0A2R8ZJ66_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag

A0A2R8ZJ66_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc
A0A2R8ZJ66_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc
A0A2R8ZJ66_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc

A0A2R8ZJ66_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2R8ZJ66_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2R8ZJ66_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca

A0A2R8ZJ66_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2R8ZJ66_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2R8ZJ66_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc

A0A2R8ZJ66_BCL2A1-      aagaaacttctacgacagcagattgccccggatgtggatacttataagga
A0A2R8ZJ66_BCL2A1-      aagaaacttctacgacagcagattgccccggatgtggatacttataagga
A0A2R8ZJ66_BCL2A1-      aagaaacttctacgacagcagattgccccggatgtggatacttataagga

A0A2R8ZJ66_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2R8ZJ66_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2R8ZJ66_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga

A0A2R8ZJ66_BCL2A1-      taagacaaaacggaggctgggggaaatggc---------acaatcacacg
A0A2R8ZJ66_BCL2A1-      taagacaaaacggaggct-gggaaaatggctttgtaaagaagtttgaaca
A0A2R8ZJ66_BCL2A1-      taagacaaaacggaggct-gggaaaatggctttgtaaagaagtttgaaca
                        ****************** *** *******         *   *   ** 

A0A2R8ZJ66_BCL2A1-      cctatgctggtagagtcagtggcccacaagaagaggaaaatggc------
A0A2R8ZJ66_BCL2A1-      taaat-ctggctggatgacttttctagaagttacaggaaagatc------
A0A2R8ZJ66_BCL2A1-      taaat-ctggctggatgacttttctagaagttacaggaaagatctcaata
                           ** ****  *  * * *   * * ***     * ***   *      

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      ---------------------------tgtgaaat---gctatctctcct
A0A2R8ZJ66_BCL2A1-      ctgttgaccagaaaggacactccatattgtgaaaccggcctaatttttct

A0A2R8ZJ66_BCL2A1-      ------------------------------------tttgtaa
A0A2R8ZJ66_BCL2A1-      ----------gaagcaa-----------------tactgttga
A0A2R8ZJ66_BCL2A1-      gactgttatggaaacgattgccaacacatacttctacttttaa
                                                             *  * *

© 1998-2021Legal notice