Dataset for CDS MCL-1 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2MG79_MCL1-01      atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcgg
A0A8C2MG79_MCL1-02      atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcgg
                        **************************************************

A0A8C2MG79_MCL1-01      cggcgccagcctgggcgcgggcggcggctctccggccggggcgcgcctca
A0A8C2MG79_MCL1-02      cggc----------------------------------------------
                        ****                                              

A0A8C2MG79_MCL1-01      cggccgaggaggccaaggcgcggcgcgaggggggaggggaggccggcctg
A0A8C2MG79_MCL1-02      --------------------------------------------------
                                                                          

A0A8C2MG79_MCL1-01      ctgcccggcgcgcgggtggccgtgcggccgccgcccgtgggcgccgagga
A0A8C2MG79_MCL1-02      ------------------------------------------------ga
                                                                        **

A0A8C2MG79_MCL1-01      ccccgacgtcaccgcgtcggccgagaggcggctgctccggtcgcccggcc
A0A8C2MG79_MCL1-02      ccccgacgtcaccgcgtcggccgagaggcggctgctccggtcgcccggcc
                        **************************************************

A0A8C2MG79_MCL1-01      tcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcc
A0A8C2MG79_MCL1-02      tcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcc
                        **************************************************

A0A8C2MG79_MCL1-01      tccaccgccgccgccgccgccatcatgtcccccgaggaggagctggacgg
A0A8C2MG79_MCL1-02      tccaccgccgccgccgccgccatcatgtcccccgaggaggagctggacgg
                        **************************************************

A0A8C2MG79_MCL1-01      ctgcgagccggaggcgctcggcaagcggccggccgtgctgcccctgctgg
A0A8C2MG79_MCL1-02      ctgcgagccggaggcgctcggcaagcggccggccgtgctgcccctgctgg
                        **************************************************

A0A8C2MG79_MCL1-01      agcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctg
A0A8C2MG79_MCL1-02      agcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctg
                        **************************************************

A0A8C2MG79_MCL1-01      ccctccacgccgccgtcggccgaggaggaggaggacgagctgtaccgcca
A0A8C2MG79_MCL1-02      ccctccacgccgccgtcggccgaggaggaggaggacgagctgtaccgcca
                        **************************************************

A0A8C2MG79_MCL1-01      gtcgctcgagatcatctcgcgctacctccgggagcaggcggccggcgtca
A0A8C2MG79_MCL1-02      gtcgctcgagatcatctcgcgctacctccgggagcaggcggccggcgtca
                        **************************************************

A0A8C2MG79_MCL1-01      aggacgcgaagccgctgggcgaggcgggcgcggcgggccggagggcgctg
A0A8C2MG79_MCL1-02      aggacgcgaagccgctgggcgaggcgggcgcggcgggccggagggcgctg
                        **************************************************

A0A8C2MG79_MCL1-01      gagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggc
A0A8C2MG79_MCL1-02      gagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggc
                        **************************************************

A0A8C2MG79_MCL1-01      cttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtca
A0A8C2MG79_MCL1-02      cttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtca
                        **************************************************

A0A8C2MG79_MCL1-01      aatctttttctcgagtgatggtccatgttttcaaggatggcataacaaac
A0A8C2MG79_MCL1-02      aatctttttctcgagtgatggtccatgttttcaaggatggcataacaaac
                        **************************************************

A0A8C2MG79_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctatgtggccaaaca
A0A8C2MG79_MCL1-02      tggggcaggattgtgactcttatttcttttggtgcctatgtggccaaaca
                        **************************************************

A0A8C2MG79_MCL1-01      cttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagta
A0A8C2MG79_MCL1-02      cttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagta
                        **************************************************

A0A8C2MG79_MCL1-01      tcacagatgttcttgtaaggacaaaacgggactggcttgtcaaacaaaga
A0A8C2MG79_MCL1-02      tcacagatgttcttgtaaggacaaaacgggactggcttgtcaaacaaaga
                        **************************************************

A0A8C2MG79_MCL1-01      ggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcgg
A0A8C2MG79_MCL1-02      ggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcgg
                        **************************************************

A0A8C2MG79_MCL1-01      catcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctg
A0A8C2MG79_MCL1-02      catcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctg
                        **************************************************

A0A8C2MG79_MCL1-01      gtctggcatatctaataagatag
A0A8C2MG79_MCL1-02      gtctggcatatctaataagatag
                        ***********************

© 1998-2022Legal notice