Dataset for CDS MCL-1 of organism Cyprinus carpio

[Download (right click)] [Alignment] [Repertoires]

18 sequence(s)

>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=921 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggtaaagccatgtg
acaacacatgtactaatctgcacattcttgttctatggtaa
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=744 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A8C1PPB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=774 residues).
atgactttgagtttgatgagaagaacagctacggtgagtctcctcggcgcgcacacggcgctcgcgcccgcgcccgcact
caaagcgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacga
acggcctgaaaggactgcatctggacggacgctatgtgtccgcggcggacgggtctctcccgaacacaccggacccgcag
gagttcggttccgccgagctgggtcgcgacacgaggcggcttttactggatttctatcgcacgcacacgggactgtgtcc
gcgggaccggaagcagcatcacgcgttaccgacaatgactcgcgttgtcgcggacattctcctaaagcacgagatcgcgt
acaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagccaagaccatg
ttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgcatctgaagga
gctgcagagagagcggtgtgtggagacggtggccgagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagagctggcatggatttgtggagtttttccgcgtggaggacgtggagtctgtggttcgtaatgctttgatg
gctgtagtcggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A8C1X8V5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=774 residues).
atgactttgagtttgatgagaagaacagctacggtgagtctcctcggcgcgcacacggcgctcgcgcccgcgcccgcact
caaagcgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacga
acggcctgaaaggactgcatctggacggacgctatgtgtccgcggcggacgggtctctcccgaacacaccggacccgcag
gagttcggttccgccgagctgggtcgcgacacgaggcggcttttactggatttctatcgcacgcacacgggactgtgtcc
gcgggaccggaagcagcatcacgcgttaccgacaatgactcgcgttgtcgcggacattctcctaaagcacgagatcgcgt
acaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagccaagaccatg
ttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgcagctgaagga
gctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagagctggcatggatttgtggagtttttccgcgtggaggacgtggagtctgtggttcgtaatgctttgatg
gctgtagtcggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A8C1Y6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=741 residues).
atgttccctgggagtaaagtttcaaacgacaacggcttttggccatgcatcggaataacagctcttaacgtctccagcag
atccagcaagccacagataatgccagaactgaaaacccagaacccgtttacaaggaacggactccagggctcggtaccat
cttcgcctgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgtatctacgacgccctggaaatggacaca
cgagagattattgacattttcttaaaaaactttaatggattgcctcattctaaacgtgggaataaacaggttctggaaac
gatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctgaatctggagc
agaaaggagaagatgtgagttttgttaagactgtggcaacagaactcttcagcgatggcatcacaaactggggtcgcatt
gccagcctgcttacatttggggcaatggtatgcaagcatcagaaggataaaggacttaccaattgtgtgagtctggtggg
gaaagagatctctaactaccttctcacagcccagcgggactggctgctcaaaaacaaagcatgggatggctttgtggaat
tttttcgtgtcccagatacagaaggggctgtgagaaacgcattgatggccattggtagtgtggctacattcggagctgca
cttgcttatttgattcggtga
>gnl|bcl2dbcds|A0A8C1YDY0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggattggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1182 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaatcaggtgatg
aagaatataagggtgacttgtctgaaacggaagatgaggtggacagtgactttgacattgatgaaggggatgaacccgac
agcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgag
gcaaaaaccaaaacaacggaaactggctgaactgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctg
aactacaggaggacatcaacaagagtgagacttttgcactttatttacacatgcacatgtga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1149 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacagggattgataagtg
agccatctccacaagaatcagtctctttcagtgtgactgccctggaaaaaatggtctgcatgcatttttggacgtcacga
catgccaacgtgcaaaacaatgaccatggaatgttgcttgcatttctgattaatacagtagcctatctgaacttttttag
ggtttcattgttttttttgttttgttttttgaccaaatgctatgcacaaatgtcattgccaggcattaaaatgatcatca
aattaatgatattttctaaaaatatataa
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=960 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaaaaaagaagtc
atgatgtgagtgagcggtgggctggacatctgagacatcacgtcagacaaaacaggtcaaagcataagtttggtctctga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1158 residues).
atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgcatgtccagactgctggatgcagaagaggagga
tgagttctacaagaccacctatggaggatttcacgacgaatcaggtgatgaagaatataagggtgacttgtctgaaacgg
aagatgaggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagcaggaggaggatgggccacgtcgc
aagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggctga
actgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctgaactacaggaggacatcaacaagaacagga
agtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgaggctgcaggagaggcaggttgctccgcgtcga
aggaagggtacaagacatgagcgacctttgacccaagctgaacttttagcagaggccaaggtcacagcacagattaacct
tcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcaggttcatatgaagcgtcagtgtgtgggatctg
ttatccgatatcactccgtgctcatgccactggtgtctgacgtcactcttaaagaggaaaacgtggatgtagagggtttg
gaccaagatgcccaacagaatccaggccctcacccttcacaagctctttcccagtcagaatcaacccttactgcgcctcc
tagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcagggcctgccaaatgctcccgcacctacatca
cattcagtgatgatgaatccttgcagcgtttctttccccagtccccacctcctcgaattcctgtccaggagatctgccct
gttacccataagccagcgctctaccgagaccccatcacagacattccctacgctaatgttcaagcttttaggatcatccg
ggaagcttataaaaagtatgtggcggcccacggcctgccctccactggcacagtgactccagccgacactactgcaaaga
atctgcgccagaagatcattattaaacaaggcatgtag
>gnl|bcl2dbcds|A0A8C2BAP8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaatggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2BAP8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=819 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaatggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctgggtgagtgaccacacactcgtgtttccttcactgcgtaactcagagccgttctgt
gtgtgtgtggagtccagtccattcaacacacgagaaacatgtatcagaccgcctgagaaaccactgttaaactcacccac
gtcttcatcagccccgtga
>gnl|bcl2dbcds|A0A8C2BPF9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccaaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgctggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctgaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2BR28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=741 residues).
atgttccctgggagtaaagtttcaaacgacaacggcttttggccatgcatcggaataacagctcttaacgtctccagcag
atccagcaagccacaggtaatgccagaactgaaaacccagaacccgtttacaaggaacggactccagggctcggtaccat
ctttgcctgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgtatctacgacgccctggaaatggacaca
cgagagattattgacattttcttaaaaaactttactggattgcctcattctaaacgtgggaataaacaggttctggaaac
gatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctgaatctggagc
agaaaggagaagatgtgagttttgttaagactgtggcaacagaactcttcagcgatggcatctcaaactggggtcgcatt
gccagcctgcttacatttggggcaatggtatgcaagcatcagaaggataaaggacttagcaattgtgtgagtctggtggg
gaaagagatctctaactaccttctcacagcccagcgggactggctgctcaaaaacaaagcatgggatggctttgtggaat
tttttcgtgtcccagatacagaaggggctgtgagaaacgcattgatggccattggtagtgtggctacattcggagctgca
cttgcttatttgattcggtga
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1908 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaatcaggtgatg
aagaatataagggtgacttgtctgaaacggaagatgaggtggacagtgactttgacattgatgaaggggatgaacccgac
agcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgag
gcaaaaaccaaaacaacggaaactggctgaactgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctg
aactacaggaggacatcaacaagaacaggaagtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgagg
ctgcaggagaggcaggttgctccgcgtcgaaggaagggtacaagacatgagcgacctttgacccaagctgaacttttagc
agaggccaaggtcacagcacagattaaccttcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcagg
ttcatatgaagcgtcagtgtgtgggatctgttatccgatatcactccgtgctcatgccactggtgtctgacgtcactctt
aaagaggaaaacgtggatgtagagggtttggaccaagatgcccaacagaatccaggccctcacccttcacaagctctttc
ccagtcagaatcaacccttactgcgcctcctagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcag
ggcctgccaaatgctcccgcacctacatcacattcagtgatgatgaatccttgcagcgtttctttccccagtccccacct
cctcgaattcctgtccaggagatctgccctgttacccataagccagcgctctaccgagaccccatcacagacattcccta
cgctaatgttcaagcttttaggatcatccgggaagcttataaaaagtatgtggcggcccacggcctgccctccactggca
cagcgactccagccgacactactgcaaagaatctgcgccagaagatcattattaaacaaggcatgtag
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1161 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacagggattgataagtg
agccatctccacaagaatcagtctctttcagtgtgactgccctggaaaaaatggtctgcatgcatttttggacgtcacga
catgccaacgtgcaaaacaatgaccatggaatgttgcttgcatttctgattaatacagtaggctatctgaacttttttag
ggtttcattgtttttttttttttgttttttttttttgaccaaatgctatgcacaaatgtcattgccagtcattaaaatga
tcatcaaattaatgatattttctaaaaatatatatgagtaa
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=960 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaaaaaagaagtc
atgatgtgagtgagcggtgggctggacatctgagacatcacgtcagacaaaacaggtcaaaacataagtttggtctctga
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1158 residues).
atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgcatgtccagactgctggatgcagaagaggagga
tgagttctacaagaccacctatggaggatttcacgacgaatcaggtgatgaagaatataagggtgacttgtctgaaacgg
aagatgaggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagcaggaggaggatgggccacgtcgc
aagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggctga
actgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctgaactacaggaggacatcaacaagaacagga
agtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgaggctgcaggagaggcaggttgctccgcgtcga
aggaagggtacaagacatgagcgacctttgacccaagctgaacttttagcagaggccaaggtcacagcacagattaacct
tcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcaggttcatatgaagcgtcagtgtgtgggatctg
ttatccgatatcactccgtgctcatgccactggtgtctgacgtcactcttaaagaggaaaacgtggatgtagagggtttg
gaccaagatgcccaacagaatccaggccctcacccttcacaagctctttcccagtcagaatcaacccttactgcgcctcc
tagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcagggcctgccaaatgctcccgcacctacatca
cattcagtgatgatgaatccttgcagcgtttctttccccagtccccacctcctcgaattcctgtccaggagatctgccct
gttacccataagccagcgctctaccgagaccccatcacagacattccctacgctaatgttcaagcttttaggatcatccg
ggaagcttataaaaagtatgtggcggcccacggcctgccctccactggcacagcgactccagccgacactactgcaaaga
atctgcgccagaagatcattattaaacaaggcatgtag
© 1998-2022Legal notice