Dataset for CDS MCL-1 of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1YDY0_MCL1-01      atgactctaagttttgggattaaa----cgaacggccgcgttgagtgtct
A0A8C1JUN1_MCL1-01      atgtttc------ctgggagtaaagtttcaaacgacaacg------gcct
A0A8C1JUN1_MCL1-02      atgtttc------ctgggagtaaagtttcaaacgacaacg------gcct
                        ***  **       ***** ****    * **** *  **      * **

A0A8C1YDY0_MCL1-01      tcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctcaaaccg
A0A8C1JUN1_MCL1-01      ttggccatgcattggaatagcagctcttaac---gtcaac-----aacag
A0A8C1JUN1_MCL1-02      ttggccatgcattggaatagcagctcttaac---gtcaac-----aacag
                        * *  ** *    * *   *  ***  ** *   * *  *     *** *

A0A8C1YDY0_MCL1-01      cgcacggaggacgagcttgacgggtacgcggatgacacggaagccgc---
A0A8C1JUN1_MCL1-01      ctc-----gagcgggtttggt----------------cgcaagccactag
A0A8C1JUN1_MCL1-02      ctc-----gagcgggtttggt----------------cgcaagccactag
                        * *     *  ** * ***                  ** ***** *   

A0A8C1YDY0_MCL1-01      ----gctgaagccgccgaggcccgggacgaacggcttgaaagggctgcag
A0A8C1JUN1_MCL1-01      taatgccagaaccg--aaagcccagaacga---gttcgcagggaacg---
A0A8C1JUN1_MCL1-02      taatgccagaaccg--aaagcccagaacga---gttcgcagggaacg---
                            **   * ***   * **** * ****   * * * * **   *   

A0A8C1YDY0_MCL1-01      ctggacgggcggttcgtgtccgcgggggacggctctctac-cggccaccc
A0A8C1JUN1_MCL1-01      -----------------gtctgcagggctcggtaccatcctcgcctgagt
A0A8C1JUN1_MCL1-02      -----------------gtctgcagggctcggtaccatcctcgcctgagt
                                         *** ** ***  ***  *  * * ** *     

A0A8C1YDY0_MCL1-01      cggacccgaaggagctgggt---------------tccgtcgagctgcat
A0A8C1JUN1_MCL1-01      cggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaa
A0A8C1JUN1_MCL1-02      cggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaa
                        *****    ****  * * *               * ** **  *** * 

A0A8C1YDY0_MCL1-01      ctggacacgcggcagcttatgttggatttctatcgcacgc-acacgggaa
A0A8C1JUN1_MCL1-01      atggacacgcgcgagattat-tgacattttcttaaaaagcttcacaggac
A0A8C1JUN1_MCL1-02      atggacacgcgcgagattat-tgacattttcttaaaaagcttcacaggac
                         **********  ** **** *   ****   *   * **  *** *** 

A0A8C1YDY0_MCL1-01      tgtgtccgccggaccggaagcgtcatcacgcg----ttaccgacaatgag
A0A8C1JUN1_MCL1-01      ----tccctcattctaaaagtggaaaaaaacagatcctatctacgatgaa
A0A8C1JUN1_MCL1-02      ----tccctcattctaaaagtggaaaaaaacagatcctatctacgatgaa
                            ***  *   *   *** *  *  *  *      ** * ** **** 

A0A8C1YDY0_MCL1-01      gcgcgtcgtcgcggacattc---tgataaagcaccagatcacttacaaag
A0A8C1JUN1_MCL1-01      gcgggttgt---ggacagtctcgtggtgaagcacgaattggcttacaaag
A0A8C1JUN1_MCL1-02      gcgggttgt---ggacagtctcgtggtgaagcacgaattggcttacaaag
                        *** ** **   ***** **   ** * ****** *  *  *********

A0A8C1YDY0_MCL1-01      gaatg-ttgcagcgtctgcagctggactctcaaccggacgacatgagctt
A0A8C1JUN1_MCL1-01      gtatgattgca-cggctgaatctggaggagaaaggagaagatgtgagttt
A0A8C1JUN1_MCL1-02      gtatgattgca-cggctgaatctggaggagaaaggagaagatgtgagttt
                        * *** ***** ** *** * *****     **   ** **  **** **

A0A8C1YDY0_MCL1-01      catcagctgtatagccaagaccatgttcaaggaccacaccacgaactggg
A0A8C1JUN1_MCL1-01      tgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactggg
A0A8C1JUN1_MCL1-02      tgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactggg
                          ***    * * ** *      * ****  **   ** *** *******

A0A8C1YDY0_MCL1-01      gccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgcagctg
A0A8C1JUN1_MCL1-01      ggcgcattgccagcctgctgacttttggggccattgtatgcaagcatcaa
A0A8C1JUN1_MCL1-02      ggcgcattgccagcctgctgacttttggggccattgtatgcaagcatcaa
                        * ** ** *  ** *** ** * ** ** *** * ** **** *** *  

A0A8C1YDY0_MCL1-01      aaggagctgcagagagagc------agtgcgtggaggcggtggccgagca
A0A8C1JUN1_MCL1-01      aatg------atagaggacttagcaagtgtgtgagtctggtgggggaaga
A0A8C1JUN1_MCL1-02      aatg------atagaggacttagcaagtgtgtgagtctggtgggggaaga
                        ** *      * ****  *      **** ***     *****  **  *

A0A8C1YDY0_MCL1-01      gatctcctcctatctgatctcagaacagcacgactggctgctcaacaaca
A0A8C1JUN1_MCL1-01      gatctcttcctatcttctcacagaccaacggcactggctgctcaaaaaca
A0A8C1JUN1_MCL1-02      gatctcttcctatcttctcacagaccaacggcactggctgctcaaaaaca
                        ****** ********  ** **** ** *   ************* ****

A0A8C1YDY0_MCL1-01      agagctggcatggattcgtggagtttttccgcgtggaggacgtggagtct
A0A8C1JUN1_MCL1-01      aagcatgggatggcttcgaggaatttttccatgtcccggatacagaggga
A0A8C1JUN1_MCL1-02      aagcatgggatggcttcgaggaatttttccatgtcccggatacagaggga
                        *    *** **** **** *** *******  **   ***    ***   

A0A8C1YDY0_MCL1-01      gtggttcgcagcgctctgatggctgttgtgggatgtgctgggattggcgc
A0A8C1JUN1_MCL1-01      gctgtgagaaacgcattgatggccattggtagttttgcaacattcggagc
A0A8C1JUN1_MCL1-02      gctgtgagaaacgcattgatggccattggtagttttgcaacattcggagc
                        *  **  * * ***  *******  ***   * * ***     * ** **

A0A8C1YDY0_MCL1-01      cggtctcgctctcctgatcc------------------------------
A0A8C1JUN1_MCL1-01      tgcacttgcttatttgatacggccatccgtggggtctaatgaggactatg
A0A8C1JUN1_MCL1-02      tgcacttgcttatttgatac------------------------------
                         *  ** ***    **** *                              

A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-01      gtaatgacacacacagggcctcacctgatcctccagctcactgtggcagc
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-01      acctgctgtggttacctgagccaggctgttaaactcagtggaatacaggt
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1YDY0_MCL1-01      -----------------------------------------------gat
A0A8C1JUN1_MCL1-01      aaagccatgtgacaacacatgtactaatctgcacattcttgttctatggt
A0A8C1JUN1_MCL1-02      -----------------------------------------------ggt
                                                                       * *

A0A8C1YDY0_MCL1-01      ga
A0A8C1JUN1_MCL1-01      aa
A0A8C1JUN1_MCL1-02      ga
                         *

© 1998-2023Legal notice