Dataset for CDS MCL-1 of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1Y6A5_MCL1-01      atg---tt---ccctgggagtaaagtt--tcaaacgacaacgg-----ct
A0A8C2BR28_MCL1-01      atg---tt---ccctgggagtaaagtt--tcaaacgacaacgg-----ct
A0A8C2A7Q5_MCL1-04      atgagttt---agctttcagcagggctcctcgaaagactgcgggaaaccg
A0A8C2KHZ4_MCL1-04      atgagttt---agctttcagcagggctcctcgaaagactgcgggaaaccg
A0A8C2KHZ4_MCL1-01      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C2KHZ4_MCL1-02      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C2KHZ4_MCL1-03      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C2A7Q5_MCL1-03      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C2A7Q5_MCL1-01      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C2A7Q5_MCL1-02      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C1JUN1_MCL1-01      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C1JUN1_MCL1-02      atg---tt---tcctgggagtaaagtt--tcaaacgacaacgg-----cc
A0A8C1PPB3_MCL1-01      atgactttgagttt---gatgaga------agaacagctacggtgagtct
A0A8C1X8V5_MCL1-01      atgactttgagttt---gatgaga------agaacagctacggtgagtct
A0A8C2BAP8_MCL1-02      atgactctaagttttgggattaaa------cgaacggccgcgttgagtgt
A0A8C2BPF9_MCL1-01      atgactctaagttttgggattaaa------cgaacggccgcgttgagtgt
A0A8C1YDY0_MCL1-01      atgactctaagttttgggattaaa------cgaacggccgcgttgagtgt
A0A8C2BAP8_MCL1-01      atgactctaagttttgggattaaa------cgaacggccgcgttgagtgt
                        ***    *          *  *          **   *  **        

A0A8C1Y6A5_MCL1-01      tttggcc----------atgca----tcggaataa---cagctcttaa--
A0A8C2BR28_MCL1-01      tttggcc----------atgca----tcggaataa---cagctcttaa--
A0A8C2A7Q5_MCL1-04      catgtccagactgctggatgca----gaagaggaggatgagttct-----
A0A8C2KHZ4_MCL1-04      catgtccagactgctggatgca----gaagaggaggatgagttct-----
A0A8C2KHZ4_MCL1-01      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C2KHZ4_MCL1-02      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C2KHZ4_MCL1-03      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C2A7Q5_MCL1-03      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C2A7Q5_MCL1-01      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C2A7Q5_MCL1-02      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C1JUN1_MCL1-01      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C1JUN1_MCL1-02      tttggcc----------atgca----ttggaatag---cagctcttaa--
A0A8C1PPB3_MCL1-01      cctc------ggcgcgcacacggcgctcgcgcccgcgcccgcactcaaag
A0A8C1X8V5_MCL1-01      cctc------ggcgcgcacacggcgctcgcgcccgcgcccgcactcaaag
A0A8C2BAP8_MCL1-02      cttcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctcaaac
A0A8C2BPF9_MCL1-01      cttcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctcaaac
A0A8C1YDY0_MCL1-01      cttcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctcaaac
A0A8C2BAP8_MCL1-01      cttcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctcaaac
                          *              *  *                   *  **     

A0A8C1Y6A5_MCL1-01      ----cgtctccagcagatccag------------caagccacagataatg
A0A8C2BR28_MCL1-01      ----cgtctccagcagatccag------------caagccacaggtaatg
A0A8C2A7Q5_MCL1-04      ------acaagaccacctatggaggatttcacgacgaatca--ggtgatg
A0A8C2KHZ4_MCL1-04      ------acaagaccacctatggaggatttcacgacgaatca--ggtgatg
A0A8C2KHZ4_MCL1-01      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C2KHZ4_MCL1-02      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C2KHZ4_MCL1-03      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C2A7Q5_MCL1-03      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C2A7Q5_MCL1-01      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C2A7Q5_MCL1-02      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C1JUN1_MCL1-01      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C1JUN1_MCL1-02      ----cgtcaacaacagctcgagcgggtttggtcgcaagccactagtaatg
A0A8C1PPB3_MCL1-01      cgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcg
A0A8C1X8V5_MCL1-01      cgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcg
A0A8C2BAP8_MCL1-02      cgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcg
A0A8C2BPF9_MCL1-01      cgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcg
A0A8C1YDY0_MCL1-01      cgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcg
A0A8C2BAP8_MCL1-01      cgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcg
                                     *                      *  *         *

A0A8C1Y6A5_MCL1-01      ccagaactg--aaaacccagaaccc---gtttacaaggaacg--------
A0A8C2BR28_MCL1-01      ccagaactg--aaaacccagaaccc---gtttacaaggaacg--------
A0A8C2A7Q5_MCL1-04      -aagaatat--aagg---gtgactt---gtctgaaacggaag--------
A0A8C2KHZ4_MCL1-04      -aagaatat--aagg---gtgactt---gtctgaaacggaag--------
A0A8C2KHZ4_MCL1-01      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C2KHZ4_MCL1-02      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C2KHZ4_MCL1-03      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C2A7Q5_MCL1-03      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C2A7Q5_MCL1-01      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C2A7Q5_MCL1-02      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C1JUN1_MCL1-01      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C1JUN1_MCL1-02      ccagaaccg--aaagcccagaacga---gttcgcagggaacg--------
A0A8C1PPB3_MCL1-01      atgaagccgttcagaccgggaacgaacggcctgaaaggactgcatctgga
A0A8C1X8V5_MCL1-01      atgaagccgttcagaccgggaacgaacggcctgaaaggactgcatctgga
A0A8C2BAP8_MCL1-02      ctgaagccgccgaggcccgggacgaatggcttgaaagggctgcagctgga
A0A8C2BPF9_MCL1-01      ctgaagccgccgaggcccgggacgaacggcttgaaagggctgcagctgga
A0A8C1YDY0_MCL1-01      ctgaagccgccgaggcccgggacgaacggcttgaaagggctgcagctgga
A0A8C2BAP8_MCL1-01      ctgaagccgccgaggcccgggacgaatggcttgaaagggctgcagctgga
                            *       *        **     *     *  *   *        

A0A8C1Y6A5_MCL1-01      ------------gactccagggctcggtaccatcttcgcc----------
A0A8C2BR28_MCL1-01      ------------gactccagggctcggtaccatctttgcc----------
A0A8C2A7Q5_MCL1-04      ------------at-----gaggtggacagtgactttgacattgatgaag
A0A8C2KHZ4_MCL1-04      ------------at-----gaggtggacagtgactttgacattgatgaag
A0A8C2KHZ4_MCL1-01      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C2KHZ4_MCL1-02      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C2KHZ4_MCL1-03      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C2A7Q5_MCL1-03      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C2A7Q5_MCL1-01      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C2A7Q5_MCL1-02      ------------gtctccagggctcggtaccatcctcgcc----------
A0A8C1JUN1_MCL1-01      ------------gtctgcagggctcggtaccatcctcgcc----------
A0A8C1JUN1_MCL1-02      ------------gtctgcagggctcggtaccatcctcgcc----------
A0A8C1PPB3_MCL1-01      cggacgctatgtgtccgcggcggacgggtctctcccgaac----------
A0A8C1X8V5_MCL1-01      cggacgctatgtgtccgcggcggacgggtctctcccgaac----------
A0A8C2BAP8_MCL1-02      cgggcggttcgtgtccgcgggggacggctctctaccggcc----------
A0A8C2BPF9_MCL1-01      cgggcggttcgtgtccgcgggggacggctctctaccggcc----------
A0A8C1YDY0_MCL1-01      cgggcggttcgtgtccgcgggggacggctctctaccggcc----------
A0A8C2BAP8_MCL1-01      cgggcggttcgtgtccgcgggggacggctctctaccggcc----------
                                           * *   *             *          

A0A8C1Y6A5_MCL1-01      ----tgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgt
A0A8C2BR28_MCL1-01      ----tgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgt
A0A8C2A7Q5_MCL1-04      gggatgaacccgacagcgagcaggaggaggatg-----------ggccac
A0A8C2KHZ4_MCL1-04      gggatgaacccgacagcgagcaggaggaggatg-----------ggccac
A0A8C2KHZ4_MCL1-01      ----tgagtcggactgcgaggaaacagttgatta---------cagcccc
A0A8C2KHZ4_MCL1-02      ----tgagtcggactgcgaggaaacagttgatta---------cagcccc
A0A8C2KHZ4_MCL1-03      ----tgagtcggactgcgaggaaacagttgatta---------cagcccc
A0A8C2A7Q5_MCL1-03      ----tgagtcggactgcgaggaaatagttgatta---------cagcccc
A0A8C2A7Q5_MCL1-01      ----tgagtcggactgcgaggaaatagttgatta---------cagcccc
A0A8C2A7Q5_MCL1-02      ----tgagtcggactgcgaggaaatagttgatta---------cagcccc
A0A8C1JUN1_MCL1-01      ----tgagtcggactgcgaggaaatagttgatta---------cagcccc
A0A8C1JUN1_MCL1-02      ----tgagtcggactgcgaggaaatagttgatta---------cagcccc
A0A8C1PPB3_MCL1-01      -----acaccggacccgcaggag------------------------ttc
A0A8C1X8V5_MCL1-01      -----acaccggacccgcaggag------------------------ttc
A0A8C2BAP8_MCL1-02      -----accccggacccgaaggag------------------------ctg
A0A8C2BPF9_MCL1-01      -----accccggacccaaaggag------------------------ctg
A0A8C1YDY0_MCL1-01      -----accccggacccgaaggag------------------------ctg
A0A8C2BAP8_MCL1-01      -----accccggacccgaaggag------------------------ctg
                                 * **     ** *                            

A0A8C1Y6A5_MCL1-01      atctacgacgccctggaaatggacacacgagagattattgacattttctt
A0A8C2BR28_MCL1-01      atctacgacgccctggaaatggacacacgagagattattgacattttctt
A0A8C2A7Q5_MCL1-04      gtc-------------------gcaagagc-agagtggtgac--------
A0A8C2KHZ4_MCL1-04      gtc-------------------gcaagagc-agagtggtgac--------
A0A8C2KHZ4_MCL1-01      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C2KHZ4_MCL1-02      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C2KHZ4_MCL1-03      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C2A7Q5_MCL1-03      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C2A7Q5_MCL1-01      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C2A7Q5_MCL1-02      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C1JUN1_MCL1-01      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C1JUN1_MCL1-02      gtctgcgccgctctggaaatggacacgcgcgagattattgacattttctt
A0A8C1PPB3_MCL1-01      ggttccgccgagctgggtcgcgacacgaggcggcttttactggatttcta
A0A8C1X8V5_MCL1-01      ggttccgccgagctgggtcgcgacacgaggcggcttttactggatttcta
A0A8C2BAP8_MCL1-02      ggttccgtcgagctgcatctggacacgcggcagcttatgttggatttcta
A0A8C2BPF9_MCL1-01      ggttccgtcgagctgcatctggacacgcggcagcttatgttggatttcta
A0A8C1YDY0_MCL1-01      ggttccgtcgagctgcatctggacacgcggcagcttatgttggatttcta
A0A8C2BAP8_MCL1-01      ggttccgtcgagctgcatctggacacgcggcagcttatgttggatttcta
                                               **   *   *  *              

A0A8C1Y6A5_MCL1-01      aaaaaactttaatggattgcctcattctaaacgtgggaataaacaggttc
A0A8C2BR28_MCL1-01      aaaaaactttactggattgcctcattctaaacgtgggaataaacaggttc
A0A8C2A7Q5_MCL1-04      -caaagcctacaaggagccagtt------aaagtggtgaggcaaaaacca
A0A8C2KHZ4_MCL1-04      -caaagcctacaaggagccagtt------aaagtggtgaggcaaaaacca
A0A8C2KHZ4_MCL1-01      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C2KHZ4_MCL1-02      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C2KHZ4_MCL1-03      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C2A7Q5_MCL1-03      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C2A7Q5_MCL1-01      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C2A7Q5_MCL1-02      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C1JUN1_MCL1-01      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C1JUN1_MCL1-02      aaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcc
A0A8C1PPB3_MCL1-01      tcgcacgcacacgggactgtgtccgcgggaccggaagcagcatcacgcgt
A0A8C1X8V5_MCL1-01      tcgcacgcacacgggactgtgtccgcgggaccggaagcagcatcacgcgt
A0A8C2BAP8_MCL1-02      tcgcacgcacacgggaatgtgtccgccggaccggaagcgtcatcacgcgt
A0A8C2BPF9_MCL1-01      tcgcacgcacacgggaatgtgtccgctggaccggaagcgtcatcacgcgt
A0A8C1YDY0_MCL1-01      tcgcacgcacacgggaatgtgtccgccggaccggaagcgtcatcacgcgt
A0A8C2BAP8_MCL1-01      tcgcacgcacacgggaatgtgtccgccggaccggaagcgtcatcacgcgt
                            *        ***     *       *  *           *     

A0A8C1Y6A5_MCL1-01      tggaaacgatgaatcgggtt-----------gtggaaagtcttgtggtga
A0A8C2BR28_MCL1-01      tggaaacgatgaatcgggtt-----------gtggaaagtcttgtggtga
A0A8C2A7Q5_MCL1-04      aaacaacg--gaaactggctgaactgcccaggaggacagtc---------
A0A8C2KHZ4_MCL1-04      aaacaacg--gaaactggctgaactgcccaggaggacagtc---------
A0A8C2KHZ4_MCL1-01      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C2KHZ4_MCL1-02      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C2KHZ4_MCL1-03      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C2A7Q5_MCL1-03      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C2A7Q5_MCL1-01      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C2A7Q5_MCL1-02      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C1JUN1_MCL1-01      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C1JUN1_MCL1-02      tatctacgatgaagcgggtt-----------gtggacagtctcgtggtga
A0A8C1PPB3_MCL1-01      taccgacaatgactcgcgttgtc--------gcggacattc---tcctaa
A0A8C1X8V5_MCL1-01      taccgacaatgactcgcgttgtc--------gcggacattc---tcctaa
A0A8C2BAP8_MCL1-02      taccgacaatgaggcgcgtcgtc--------gcggacattc---tgataa
A0A8C2BPF9_MCL1-01      taccgacaatgaggcgcgtcgtc--------gcggacattc---tgataa
A0A8C1YDY0_MCL1-01      taccgacaatgaggcgcgtcgtc--------gcggacattc---tgataa
A0A8C2BAP8_MCL1-01      taccgacaatgaggcgcgtcgtc--------gcggacattc---tgataa
                             **   **  *  *             * *** * **         

A0A8C1Y6A5_MCL1-01      agcacgaactggcttacaaaggtatgatcgcacggctgaat--ctggagc
A0A8C2BR28_MCL1-01      agcacgaactggcttacaaaggtatgatcgcacggctgaat--ctggagc
A0A8C2A7Q5_MCL1-04      aagacaaa--gatcaacaaataca-----acccccctgaactacaggagg
A0A8C2KHZ4_MCL1-04      aagacaaa--gatcaacaaataca-----acccccctgaactacaggagg
A0A8C2KHZ4_MCL1-01      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C2KHZ4_MCL1-02      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C2KHZ4_MCL1-03      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C2A7Q5_MCL1-03      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C2A7Q5_MCL1-01      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C2A7Q5_MCL1-02      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C1JUN1_MCL1-01      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C1JUN1_MCL1-02      agcacgaattggcttacaaaggtatgattgcacggctgaat--ctggagg
A0A8C1PPB3_MCL1-01      agcacgagatcgcgtacaaaggaatgttgcagcgtctgcag--ctggact
A0A8C1X8V5_MCL1-01      agcacgagatcgcgtacaaaggaatgttgcagcgtctgcag--ctggact
A0A8C2BAP8_MCL1-02      agcaccagatcacttacaaaggaatgttgcagcgtctgcag--ctggact
A0A8C2BPF9_MCL1-01      agcaccagatcacttacaaaggaatgttgcagcgtctgcag--ctggact
A0A8C1YDY0_MCL1-01      agcaccagatcacttacaaaggaatgttgcagcgtctgcag--ctggact
A0A8C2BAP8_MCL1-01      agcaccagatcacttacaaaggaatgttgcagcgtctgcag--ctggact
                        *  ** *        *****   *        *  *** *   * ***  

A0A8C1Y6A5_MCL1-01      aga-----aaggagaagatgtgagt---tttgttaagactgtggcaacag
A0A8C2BR28_MCL1-01      aga-----aaggagaagatgtgagt---tttgttaagactgtggcaacag
A0A8C2A7Q5_MCL1-04      acatcaacaagaacaggaagtcggtgcgtcagtcaa--------caacag
A0A8C2KHZ4_MCL1-04      acatcaacaagaacaggaagtcggtgcgtcagtcaa--------caacag
A0A8C2KHZ4_MCL1-01      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C2KHZ4_MCL1-02      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C2KHZ4_MCL1-03      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C2A7Q5_MCL1-03      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C2A7Q5_MCL1-01      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C2A7Q5_MCL1-02      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C1JUN1_MCL1-01      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C1JUN1_MCL1-02      aga-----aaggagaagatgtgagt---tttgtcaagactgtggcaacag
A0A8C1PPB3_MCL1-01      ctc-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
A0A8C1X8V5_MCL1-01      ctc-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
A0A8C2BAP8_MCL1-02      ctc-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
A0A8C2BPF9_MCL1-01      ctg-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
A0A8C1YDY0_MCL1-01      ctc-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
A0A8C2BAP8_MCL1-01      ctc-----aaccggacgacatgagc---ttcatcagctgtatagccaaga
                                **    * **  *  *    *   * *         * *   

A0A8C1Y6A5_MCL1-01      aactcttcagcgatggcatcacaaactggggtcgcatt---gccagcctg
A0A8C2BR28_MCL1-01      aactcttcagcgatggcatctcaaactggggtcgcatt---gccagcctg
A0A8C2A7Q5_MCL1-04      aacacacaag-gttgacgt----acctgaggctgcaggagaggcaggttg
A0A8C2KHZ4_MCL1-04      aacacacaag-gttgacgt----acctgaggctgcaggagaggcaggttg
A0A8C2KHZ4_MCL1-01      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C2KHZ4_MCL1-02      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C2KHZ4_MCL1-03      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C2A7Q5_MCL1-03      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C2A7Q5_MCL1-01      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C2A7Q5_MCL1-02      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C1JUN1_MCL1-01      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C1JUN1_MCL1-02      agctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctg
A0A8C1PPB3_MCL1-01      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
A0A8C1X8V5_MCL1-01      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
A0A8C2BAP8_MCL1-02      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
A0A8C2BPF9_MCL1-01      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
A0A8C1YDY0_MCL1-01      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
A0A8C2BAP8_MCL1-01      ccatgttcaaggaccacaccacgaactggggccggatc---gtgagtctg
                                *  *    *      * *** **  * *     *  **  **

A0A8C1Y6A5_MCL1-01      cttacatttggggcaatggtatgcaagcatcagaagg------ataaagg
A0A8C2BR28_MCL1-01      cttacatttggggcaatggtatgcaagcatcagaagg------ataaagg
A0A8C2A7Q5_MCL1-04      ctccgcgtcgaaggaagggta---------caagaca------tgagcga
A0A8C2KHZ4_MCL1-04      ctccgcgtcgaaggaagggta---------caagaca------tgagcga
A0A8C2KHZ4_MCL1-01      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C2KHZ4_MCL1-02      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C2KHZ4_MCL1-03      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C2A7Q5_MCL1-03      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C2A7Q5_MCL1-01      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C2A7Q5_MCL1-02      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C1JUN1_MCL1-01      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C1JUN1_MCL1-02      ctgacttttggggccattgtatgcaagcatcaaaatg------atagagg
A0A8C1PPB3_MCL1-01      gtggcgttcggagccgtggtgtgcacgcatctgaaggagctgcagagaga
A0A8C1X8V5_MCL1-01      gtggcgttcggagccgtggtgtgcacgcagctgaaggagctgcagagaga
A0A8C2BAP8_MCL1-02      gtggcgttcggagccgtggtgtgcacgcagctgaaggagctgcagagaga
A0A8C2BPF9_MCL1-01      gtggcgttcggagccgtggtgtgcacgcagctgaaggagctgcagagaga
A0A8C1YDY0_MCL1-01      gtggcgttcggagccgtggtgtgcacgcagctgaaggagctgcagagaga
A0A8C2BAP8_MCL1-01      gtggcgttcggagccgtggtgtgcacgcagctgaaggagctgcagagaga
                         *     * *  *     **          *   *          *  * 

A0A8C1Y6A5_MCL1-01      acttac---caattgtgtgagtctggtggggaaagagatctctaactacc
A0A8C2BR28_MCL1-01      acttag---caattgtgtgagtctggtggggaaagagatctctaactacc
A0A8C2A7Q5_MCL1-04      cctttgacccaagc-tgaacttttagcagaggccaaggtcac--------
A0A8C2KHZ4_MCL1-04      cctttgacccaagc-tgaacttttagcagaggccaaggtcac--------
A0A8C2KHZ4_MCL1-01      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C2KHZ4_MCL1-02      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C2KHZ4_MCL1-03      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C2A7Q5_MCL1-03      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C2A7Q5_MCL1-01      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C2A7Q5_MCL1-02      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C1JUN1_MCL1-01      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C1JUN1_MCL1-02      acttag---caagtgtgtgagtctggtgggggaagagatctcttcctatc
A0A8C1PPB3_MCL1-01      gc---------ggtgtgtggagacggtggccgagcagatctcctcctatc
A0A8C1X8V5_MCL1-01      gc---------ggtgcgtggaggcggtggccgagcagatctcctcctatc
A0A8C2BAP8_MCL1-02      gc---------ggtgcgtggaggcggtggccgagcagatctcctcctatc
A0A8C2BPF9_MCL1-01      gc---------ggtgcgtggaggcggtggccgagcagatctcctcctatc
A0A8C1YDY0_MCL1-01      gc---------agtgcgtggaggcggtggccgagcagatctcctcctatc
A0A8C2BAP8_MCL1-01      gc---------ggtgcgtggaggcggtggccgagcagatctcctcctatc
                         *              *        *  *      ** ** *        

A0A8C1Y6A5_MCL1-01      ttctcacagcccagcgggactggctgctcaaaaacaa--agcatgg----
A0A8C2BR28_MCL1-01      ttctcacagcccagcgggactggctgctcaaaaacaa--agcatgg----
A0A8C2A7Q5_MCL1-04      --agcacagattaac--cttcgatcactggaaaactatgagcgttt----
A0A8C2KHZ4_MCL1-04      --agcacagattaac--cttcgatcactggaaaactatgagcgttt----
A0A8C2KHZ4_MCL1-01      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C2KHZ4_MCL1-02      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C2KHZ4_MCL1-03      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C2A7Q5_MCL1-03      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C2A7Q5_MCL1-01      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C2A7Q5_MCL1-02      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C1JUN1_MCL1-01      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C1JUN1_MCL1-02      ttctcacagaccaacggcactggctgctcaaaaacaa--agcatgg----
A0A8C1PPB3_MCL1-01      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgg----
A0A8C1X8V5_MCL1-01      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgg----
A0A8C2BAP8_MCL1-02      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgggtga
A0A8C2BPF9_MCL1-01      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgg----
A0A8C1YDY0_MCL1-01      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgg----
A0A8C2BAP8_MCL1-01      tgatctcagaacagcacgactggctgctcaacaacaa--gagctgg----
                            * ***   * *      *    **  * *** *      *      

A0A8C1Y6A5_MCL1-01      -----gatggctttgtg---------------------gaattttttcgt
A0A8C2BR28_MCL1-01      -----gatggctttgtg---------------------gaattttttcgt
A0A8C2A7Q5_MCL1-04      -----ggaggcagataa---------------------gaa-------ac
A0A8C2KHZ4_MCL1-04      -----ggaggcagataa---------------------gaa-------ac
A0A8C2KHZ4_MCL1-01      -----gatggcttcgag---------------------gaatttttccat
A0A8C2KHZ4_MCL1-02      -----gatggcttcgag---------------------gaatttttccat
A0A8C2KHZ4_MCL1-03      -----gatggcttcgag---------------------gaatttttccat
A0A8C2A7Q5_MCL1-03      -----gatggcttcgag---------------------gaatttttccat
A0A8C2A7Q5_MCL1-01      -----gatggcttcgag---------------------gaatttttccat
A0A8C2A7Q5_MCL1-02      -----gatggcttcgag---------------------gaatttttccat
A0A8C1JUN1_MCL1-01      -----gatggcttcgag---------------------gaatttttccat
A0A8C1JUN1_MCL1-02      -----gatggcttcgag---------------------gaatttttccat
A0A8C1PPB3_MCL1-01      -----catggatttgtg---------------------gagtttttccgc
A0A8C1X8V5_MCL1-01      -----catggatttgtg---------------------gagtttttccgc
A0A8C2BAP8_MCL1-02      gtgaccacacactcgtgtttccttcactgcgtaactcagagccgttctgt
A0A8C2BPF9_MCL1-01      -----catggattcgtg---------------------gagtttttccgc
A0A8C1YDY0_MCL1-01      -----catggattcgtg---------------------gagtttttccgc
A0A8C2BAP8_MCL1-01      -----catggattcgtg---------------------gagtttttccgc
                                                              **          

A0A8C1Y6A5_MCL1-01      gtcccagatacagaaggggc-----tgtgagaaacgcatt----gatggc
A0A8C2BR28_MCL1-01      gtcccagatacagaaggggc-----tgtgagaaacgcatt----gatggc
A0A8C2A7Q5_MCL1-04      gt--caggttcatatgaagcgtcagtgtgtgggatctgttatccgatatc
A0A8C2KHZ4_MCL1-04      gt--caggttcatatgaagcgtcagtgtgtgggatctgttatccgatatc
A0A8C2KHZ4_MCL1-01      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C2KHZ4_MCL1-02      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C2KHZ4_MCL1-03      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C2A7Q5_MCL1-03      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C2A7Q5_MCL1-01      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C2A7Q5_MCL1-02      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C1JUN1_MCL1-01      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C1JUN1_MCL1-02      gtcccggatacagagggagc-----tgtgagaaacgcatt----gatggc
A0A8C1PPB3_MCL1-01      gtggaggacgtggagtctgt-----ggttcgtaatgcttt----gatggc
A0A8C1X8V5_MCL1-01      gtggaggacgtggagtctgt-----ggttcgtaatgcttt----gatggc
A0A8C2BAP8_MCL1-02      gt---gtgtgtggagtccag-----tccattcaacacacg----agaaac
A0A8C2BPF9_MCL1-01      gtggaggacgtggagtctgt-----ggttcgcagcgctct----gatggc
A0A8C1YDY0_MCL1-01      gtggaggacgtggagtctgt-----ggttcgcagcgctct----gatggc
A0A8C2BAP8_MCL1-01      gtggaggacgtggagtctgt-----ggttcgcagcgctct----gatggc
                        **           *                                   *

A0A8C1Y6A5_MCL1-01      cattggtagtgtggctaca--ttcggagctgcacttgctt---atttgat
A0A8C2BR28_MCL1-01      cattggtagtgtggctaca--ttcggagctgcacttgctt---atttgat
A0A8C2A7Q5_MCL1-04      actccgtgctcatgc--ca--ctggtgtctgacgtcac------tcttaa
A0A8C2KHZ4_MCL1-04      actccgtgctcatgc--ca--ctggtgtctgacgtcac------tcttaa
A0A8C2KHZ4_MCL1-01      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C2KHZ4_MCL1-02      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C2KHZ4_MCL1-03      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C2A7Q5_MCL1-03      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C2A7Q5_MCL1-01      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C2A7Q5_MCL1-02      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C1JUN1_MCL1-01      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C1JUN1_MCL1-02      cattggtagttttgcaaca--ttcggagctgcacttgctt---atttgat
A0A8C1PPB3_MCL1-01      tgtagtcggatgcgctggg--atcggcgccggtctcgctt---tcctgat
A0A8C1X8V5_MCL1-01      tgtagtcggatgcgctggg--atcggcgccggtctcgctt---tcctgat
A0A8C2BAP8_MCL1-02      atgtatcagaccgcctgagaaaccactgttaaactcacccacgtcttcat
A0A8C2BPF9_MCL1-01      tgttgtgggatgtgctggg--atcggcgccggtctcgctc---tcctgat
A0A8C1YDY0_MCL1-01      tgttgtgggatgtgctggg--attggcgccggtctcgctc---tcctgat
A0A8C2BAP8_MCL1-01      tgttgtgggatgtgctggg--atcggcgccggtctcgctc---tcctgat
                                      *                   *  *        * * 

A0A8C1Y6A5_MCL1-01      tcg----g------------------------------------------
A0A8C2BR28_MCL1-01      tcg----g------------------------------------------
A0A8C2A7Q5_MCL1-04      aga----ggaaaacgtgga---tgtagagggtttggaccaagatgcccaa
A0A8C2KHZ4_MCL1-04      aga----ggaaaacgtgga---tgtagagggtttggaccaagatgcccaa
A0A8C2KHZ4_MCL1-01      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C2KHZ4_MCL1-02      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C2KHZ4_MCL1-03      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C2A7Q5_MCL1-03      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C2A7Q5_MCL1-01      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C2A7Q5_MCL1-02      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C1JUN1_MCL1-01      acg----gccatccgtggggtctaatgaggactatggtaatgacacaca-
A0A8C1JUN1_MCL1-02      ac------------------------------------------------
A0A8C1PPB3_MCL1-01      ccg----g------------------------------------------
A0A8C1X8V5_MCL1-01      ccg----g------------------------------------------
A0A8C2BAP8_MCL1-02      cagccccg------------------------------------------
A0A8C2BPF9_MCL1-01      ccg----a------------------------------------------
A0A8C1YDY0_MCL1-01      ccg----a------------------------------------------
A0A8C2BAP8_MCL1-01      ccg----a------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      cagaatccaggccctcaccc--ttcacaagctctttcccagtcagaatca
A0A8C2KHZ4_MCL1-04      cagaatccaggccctcaccc--ttcacaagctctttcccagtcagaatca
A0A8C2KHZ4_MCL1-01      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C2KHZ4_MCL1-02      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C2KHZ4_MCL1-03      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C2A7Q5_MCL1-03      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C2A7Q5_MCL1-01      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C2A7Q5_MCL1-02      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C1JUN1_MCL1-01      -------cagggcctcacctgatcctccagctcact--------gtggca
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      acccttactgcgcctcctagtgtcttctcttctaacacagctg-------
A0A8C2KHZ4_MCL1-04      acccttactgcgcctcctagtgtcttctcttctaacacagctg-------
A0A8C2KHZ4_MCL1-01      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C2KHZ4_MCL1-02      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C2KHZ4_MCL1-03      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C2A7Q5_MCL1-03      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C2A7Q5_MCL1-01      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C2A7Q5_MCL1-02      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C1JUN1_MCL1-01      gcacctgctgtggttacctgagccaggctgttaaactcagtggaatacag
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      gaatcaggtgatgaagaatataagggtgacttgtctgaaacggaagatga
A0A8C2KHZ4_MCL1-02      ggattg---------------ataagtgagccatctccacaagaatcagt
A0A8C2KHZ4_MCL1-03      gaaaaaagaagtcatgat---gtgagtga---------------------
A0A8C2A7Q5_MCL1-03      gaaaaaagaagtcatgat---gtgagtga---------------------
A0A8C2A7Q5_MCL1-01      gaatcaggtgatgaagaatataagggtgacttgtctgaaacggaagatga
A0A8C2A7Q5_MCL1-02      ggattg---------------ataagtgagccatctccacaagaatcagt
A0A8C1JUN1_MCL1-01      gtaaag---------------ccatgtga---------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ------ctgtaaacccttccctgtcatcagggcctg--------------
A0A8C2KHZ4_MCL1-04      ------ctgtaaacccttccctgtcatcagggcctg--------------
A0A8C2KHZ4_MCL1-01      ggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagc
A0A8C2KHZ4_MCL1-02      ctctttcagtgtgactgccctggaaaaaatggtc---------------t
A0A8C2KHZ4_MCL1-03      -----gcggtgggctggacat-----------------------------
A0A8C2A7Q5_MCL1-03      -----gcggtgggctggacat-----------------------------
A0A8C2A7Q5_MCL1-01      ggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagc
A0A8C2A7Q5_MCL1-02      ctctttcagtgtgactgccctggaaaaaatggtc---------------t
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      aggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctac
A0A8C2KHZ4_MCL1-02      gcatgcatttttggacgtcacgacatgccaacgtgcaaaacaatgaccat
A0A8C2KHZ4_MCL1-03      ---------ctgagacatcacgtcaga-----------------------
A0A8C2A7Q5_MCL1-03      ---------ctgagacatcacgtcaga-----------------------
A0A8C2A7Q5_MCL1-01      aggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctac
A0A8C2A7Q5_MCL1-02      gcatgcatttttggacgtcacgacatgccaacgtgcaaaacaatgaccat
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      -----------------------ccaaatgctcccgcacctacatcacat
A0A8C2KHZ4_MCL1-04      -----------------------ccaaatgctcccgcacctacatcacat
A0A8C2KHZ4_MCL1-01      aaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggc
A0A8C2KHZ4_MCL1-02      ggaatgttgcttgcatttctgattaatacagtaggctatctgaacttttt
A0A8C2KHZ4_MCL1-03      -----------------------caaaacaggtcaaaacataagtttggt
A0A8C2A7Q5_MCL1-03      -----------------------caaaacaggtcaaagcataagtttggt
A0A8C2A7Q5_MCL1-01      aaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggc
A0A8C2A7Q5_MCL1-02      ggaatgttgcttgcatttctgattaatacagtagcctatctgaacttttt
A0A8C1JUN1_MCL1-01      -----------------------caacacatgtactaatctgcacattct
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      t-------------------------------------------------
A0A8C2KHZ4_MCL1-04      t-------------------------------------------------
A0A8C2KHZ4_MCL1-01      tgaactgcccaggaggacagtcaagac------aaagatcaacaaataca
A0A8C2KHZ4_MCL1-02      tagggtttcattgtttttttttttttgttttttttttttgaccaaatgct
A0A8C2KHZ4_MCL1-03      c-------------------------------------------------
A0A8C2A7Q5_MCL1-03      c-------------------------------------------------
A0A8C2A7Q5_MCL1-01      tgaactgcccaggaggacagtcaagac------aaagatcaacaaataca
A0A8C2A7Q5_MCL1-02      tagggtttcattgttttttttgttttg------ttttttgaccaaatgct
A0A8C1JUN1_MCL1-01      t--------------------------------------------gttct
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      acccccctgaactacaggaggacatcaacaagaacaggaagtcggtgcgt
A0A8C2KHZ4_MCL1-02      atgcacaaatgtcattgccagtcattaaaatgatcatcaaattaat----
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      acccccctgaactacaggaggacatcaacaagagtgagacttttgc----
A0A8C2A7Q5_MCL1-02      atgcacaaatgtcattgccaggcattaaaatgatcatcaaattaat----
A0A8C1JUN1_MCL1-01      atg-----------------------------------------------
A0A8C1JUN1_MCL1-02      --g-----------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cagtcaacaacagaacacacaaggttgacgtacctgaggctgcaggagag
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      gcaggttgctccgcgtcgaaggaagggtacaagacatgagcgacctttga
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cccaagctgaacttttagcagaggccaaggtcacagcacagattaacctt
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cgatcactggaaaactatgagcgtttggaggcagataagaaacgtcaggt
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      tcatatgaagcgtcagtgtgtgggatctgttatccgatatcactccgtgc
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      tcatgccactggtgtctgacgtcactcttaaagaggaaaacgtggatgta
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      gagggtttggaccaagatgcccaacagaatccaggccctcacccttcaca
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      agctctttcccagtcagaatcaacccttactgcgcctcctagtgtcttct
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cttctaacacagctgctgtaaacccttccctgtcatcagggcctgccaaa
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      -----------------------cagtgatgatgaatccttgcagcgttt
A0A8C2KHZ4_MCL1-04      -----------------------cagtgatgatgaatccttgcagcgttt
A0A8C2KHZ4_MCL1-01      tgctcccgcacctacatcacattcagtgatgatgaatccttgcagcgttt
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ctttccccagtccccacctcctcgaattcctgtccaggagatctgccctg
A0A8C2KHZ4_MCL1-04      ctttccccagtccccacctcctcgaattcctgtccaggagatctgccctg
A0A8C2KHZ4_MCL1-01      ctttccccagtccccacctcctcgaattcctgtccaggagatctgccctg
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ttacccataagccagcgctctaccgagaccccatcacagacattccctac
A0A8C2KHZ4_MCL1-04      ttacccataagccagcgctctaccgagaccccatcacagacattccctac
A0A8C2KHZ4_MCL1-01      ttacccataagccagcgctctaccgagaccccatcacagacattccctac
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      gctaatgttcaagcttttaggatcatccgggaagcttataaaaagtatgt
A0A8C2KHZ4_MCL1-04      gctaatgttcaagcttttaggatcatccgggaagcttataaaaagtatgt
A0A8C2KHZ4_MCL1-01      gctaatgttcaagcttttaggatcatccgggaagcttataaaaagtatgt
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ggcggcccacggcctgccctccactggcacagtgactccagccgacacta
A0A8C2KHZ4_MCL1-04      ggcggcccacggcctgccctccactggcacagcgactccagccgacacta
A0A8C2KHZ4_MCL1-01      ggcggcccacggcctgccctccactggcacagcgactccagccgacacta
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C1Y6A5_MCL1-01      --------------------------------------------tga---
A0A8C2BR28_MCL1-01      --------------------------------------------tga---
A0A8C2A7Q5_MCL1-04      ctgcaaagaatctgcgccagaagatcattattaaacaaggcatgtag---
A0A8C2KHZ4_MCL1-04      ctgcaaagaatctgcgccagaagatcattattaaacaaggcatgtag---
A0A8C2KHZ4_MCL1-01      ctgcaaagaatctgcgccagaagatcattattaaacaaggcatgtag---
A0A8C2KHZ4_MCL1-02      ----------------------gatattttctaaaa-atatatatgagta
A0A8C2KHZ4_MCL1-03      ------------------------------------------tctga---
A0A8C2A7Q5_MCL1-03      ------------------------------------------tctga---
A0A8C2A7Q5_MCL1-01      ----------------------actttatttacacatgcacatgtga---
A0A8C2A7Q5_MCL1-02      ----------------------gatattttctaaaa---atatataa---
A0A8C1JUN1_MCL1-01      -------------------------------------------gtaa---
A0A8C1JUN1_MCL1-02      -------------------------------------------gtga---
A0A8C1PPB3_MCL1-01      --------------------------------------------tga---
A0A8C1X8V5_MCL1-01      --------------------------------------------tga---
A0A8C2BAP8_MCL1-02      --------------------------------------------tga---
A0A8C2BPF9_MCL1-01      --------------------------------------------tga---
A0A8C1YDY0_MCL1-01      --------------------------------------------tga---
A0A8C2BAP8_MCL1-01      --------------------------------------------tga---
                                                                    *     

A0A8C1Y6A5_MCL1-01      -
A0A8C2BR28_MCL1-01      -
A0A8C2A7Q5_MCL1-04      -
A0A8C2KHZ4_MCL1-04      -
A0A8C2KHZ4_MCL1-01      -
A0A8C2KHZ4_MCL1-02      a
A0A8C2KHZ4_MCL1-03      -
A0A8C2A7Q5_MCL1-03      -
A0A8C2A7Q5_MCL1-01      -
A0A8C2A7Q5_MCL1-02      -
A0A8C1JUN1_MCL1-01      -
A0A8C1JUN1_MCL1-02      -
A0A8C1PPB3_MCL1-01      -
A0A8C1X8V5_MCL1-01      -
A0A8C2BAP8_MCL1-02      -
A0A8C2BPF9_MCL1-01      -
A0A8C1YDY0_MCL1-01      -
A0A8C2BAP8_MCL1-01      -
                         

© 1998-2022Legal notice