Dataset for CDS BCL-2-like of organism Canis lupus dingo

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0KQ53_BCL2A1-      atg----------------------------------------acggact
A0A8C0KWE3_BCL2-01      atg----------------gcgc--------------------acgctgg
A0A8C0L4C8_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgg
                        ***                                        **     

A0A8C0KQ53_BCL2A1-      gcgagtttgg--------ctacacgctggcgctgg---------------
A0A8C0KWE3_BCL2-01      gcgaacagggtacgataaccgggagatagtgatga-agtacatccactac
A0A8C0L4C8_MCL1-01      gggggccggg--------ctgggggccggcagcggcggcgcctcctcttc
                        * *     **        *     *   *    *                

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      aagctgtc---------------gcagaggggctacga-------gtggg
A0A8C0L4C8_MCL1-01      gggagggcggcttttggcttcggggaaggaggccacgaccagacgggagg
                                                                          

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      acgcgggagaggcgggcgccgcg---------------------------
A0A8C0L4C8_MCL1-01      gagggggaggggaagccggtgcggtgattggcggaagcgccggcgcaagt
                                                                          

A0A8C0KQ53_BCL2A1-      ---cccaggactac----gtgaggcacgtcctgcagatcccgcagccc--
A0A8C0KWE3_BCL2-01      cccccgggggccgcccccgcgccgggcatct---ccgcctcgcagccc--
A0A8C0L4C8_MCL1-01      ccccc---gaccactctggcgccggacgcccggagggtcgcgcggccctc
                           **   * *  *    * *  *  *  *        * *** ****  

A0A8C0KQ53_BCL2A1-      ----------------ggcccggcccccagcagagcgtcc---agggtgc
A0A8C0KWE3_BCL2-01      ----------------ggcc---gcgcccccgcgcccgcc---aggacct
A0A8C0L4C8_MCL1-01      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgc
                                        ****    *  *  *    *  **   ***    

A0A8C0KQ53_BCL2A1-      tccaggacgtggccttc-tccgtcc-------------------------
A0A8C0KWE3_BCL2-01      cgccgcccccgcccccc-gccgcccccgccgccgcc--------------
A0A8C0L4C8_MCL1-01      tgctgctcgcgcccccctgccg--cgcgtcgccgcctgaagagatggaag
                          * *  *  * **  *  ***  *                         

A0A8C0KQ53_BCL2A1-      ----------------------------------aggggcaggtggaaaa
A0A8C0KWE3_BCL2-01      -----gccgccgccgccgccgcg---------------------ggcccc
A0A8C0L4C8_MCL1-01      gcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtac
                                                                    **    

A0A8C0KQ53_BCL2A1-      gaacctgaagccgt------------------------------------
A0A8C0KWE3_BCL2-01      gcgcccagccccgt------gccacctgtggtccacctgaccctgc----
A0A8C0L4C8_MCL1-01      gagccggaacctttggggaagcggccggcggt---cctgcctctgctgga
                        *  **     *  *                                    

A0A8C0KQ53_BCL2A1-      -----------------------------gcttggacagttt--------
A0A8C0KWE3_BCL2-01      --------gccaggccggc---------------gacgactt----ctcc
A0A8C0L4C8_MCL1-01      gttggtgggggaggccagcagtggccccggcatggacggctcgctaccct
                                                          ***   *         

A0A8C0KQ53_BCL2A1-      -------------------------------tgacgt-------------
A0A8C0KWE3_BCL2-01      cgccgctaccgccg-----------------cgactt-------------
A0A8C0L4C8_MCL1-01      cgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtcc
                                                        **  *             

A0A8C0KQ53_BCL2A1-      ----------------ggtgtc-------------------tgtcgaca-
A0A8C0KWE3_BCL2-01      -----------------------------------------cgccgaga-
A0A8C0L4C8_MCL1-01      ctggagattatctctcggtaccttcgggaacaggccacaggcgccaagga
                                                                  * * *   

A0A8C0KQ53_BCL2A1-      --------------------------cggccag-----------------
A0A8C0KWE3_BCL2-01      ----------------------tgtccagccagct-----gcacctgacg
A0A8C0L4C8_MCL1-01      cgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagaga
                                                  * *****                 

A0A8C0KQ53_BCL2A1-      --------------------------------aaccata-----------
A0A8C0KWE3_BCL2-01      cccttc---------------------------accgcgag---------
A0A8C0L4C8_MCL1-01      ccctccggcgagtcggggacggggtacagcgcaaccacgagacagccttc
                                                         ***              

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      ---gggacgct---------------------------------------
A0A8C0L4C8_MCL1-01      caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatc
                                                                          

A0A8C0KQ53_BCL2A1-      -ttcaatcaggtgatggagaaggaatttgaagacggcgtcattaactggg
A0A8C0KWE3_BCL2-01      -ttgccacg-gtggtggaggagctcttcagggatggggt---gaactggg
A0A8C0L4C8_MCL1-01      gttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggg
                         **    *  *** * *   *    **    ** ** **    *******

A0A8C0KQ53_BCL2A1-      gaaggatcgtgaccgtttttgcctttga----------------------
A0A8C0KWE3_BCL2-01      ggaggatcgtggc------cttctttgagttcggtggggtcatgtgtgtg
A0A8C0L4C8_MCL1-01      gcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttg
                        * ***** *** *         *****                       

A0A8C0KQ53_BCL2A1-      aggaattctcaccaagaaact---------cctcgagcagcgaatttcct
A0A8C0KWE3_BCL2-01      gagagcgtcaaccgggaga----tgtcg--cccctggtggacaacatcgc
A0A8C0L4C8_MCL1-01      aagagtataaaccaagaaagctgcatcgaaccattagcagaaagcatcac
                          **      ***  ** *           **    *  *  *   **  

A0A8C0KQ53_BCL2A1-      cggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacg
A0A8C0KWE3_BCL2-01      c--ctgtggatg---------------ac----t----gagtacctgaac
A0A8C0L4C8_MCL1-01      -------agatg---------------ttctcgt----aaggac--gaaa
                                ****                     *     **  *   *  

A0A8C0KQ53_BCL2A1-      agaaacatgagagactggataagacaaaacggaggctgggaaaacggctt
A0A8C0KWE3_BCL2-01      cggcatctgcacacctggatccaggacaacggaggctggg---atgcctt
A0A8C0L4C8_MCL1-01      cgagactggctagtc--------aaacaa-agaggctggg---atgggtt
                         *  *   *     *          * **  *********   * *  **

A0A8C0KQ53_BCL2A1-      tgtgaagaagttc--------gaaccca------------------agtc
A0A8C0KWE3_BCL2-01      tgtggaactgtac--------ggccccaccatgcagcctctgtttgactt
A0A8C0L4C8_MCL1-01      tgtggagttcttccatgtagaggacctagaaggtggcatc----agaaat
                        **** *    * *        *  ** *                  *   

A0A8C0KQ53_BCL2A1-      tggatggctgacttttctggaagttctgggaacag----tgtgtgaaatg
A0A8C0KWE3_BCL2-01      ctcctggctgtctctgaaggcgctgctcagtctggccctggtgggagctt
A0A8C0L4C8_MCL1-01      gtgctgctggcttttgcaggtgttgctgg----------agtaggagctg
                            **   *  * *   **   * **             **  **  * 

A0A8C0KQ53_BCL2A1-      tggtcacacctaaagcaatacta----ctga-----
A0A8C0KWE3_BCL2-01      gcatcaccctgggtgcctatctgggccataagtga-
A0A8C0L4C8_MCL1-01      gttt---------ggcatatcta----ataagatag
                           *          **    **      * *     

© 1998-2023Legal notice