Dataset for CDS BCL-2-like of organism Canis lupus dingo

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0KQ53_BCL2A1-      atgacggactgcgagt---ttg---gctacacgctggcgctggcccagga
A0A8C0KWE3_BCL2-01      atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaa
A0A8C0JVF6_BCL2L1-      atg----------tct---cag----agcaac-cgggagctggtggttga
A0A8C0JVF6_BCL2L1-      atg----------tct---cag----agcaac-cgggagctggtggttga
A0A8C0K082_BCL2L2-      atggcgaccccagcct---cagccccagacacacgggctctagtggcaga
A0A8C0K082_BCL2L2-      atggcgaccccagcct---cagccccagacacacgggctctagtggcaga
A0A8C0L4C8_MCL1-01      atg-----ttcggcct---caa---gagaaacgcag----taat--cgga
                        ***                           *  * *    *        *

A0A8C0KQ53_BCL2A1-      ctacgtgaggcacgtcct-----------gcagatcccgcagcccggc--
A0A8C0KWE3_BCL2-01      gtacatccactacaagct-----------------gtcgcagaggggcta
A0A8C0JVF6_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A8C0JVF6_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A8C0K082_BCL2L2-      ctttgtaggctataagct-----------------gaggcagaagggtta
A0A8C0K082_BCL2L2-      ctttgtaggctataagct-----------------gaggcagaagggtta
A0A8C0L4C8_MCL1-01      ct---caacctctactgt-----------------gggggggccgggctg
                         *               *                    *  *   *    

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      cgagtgggacgcgggagaggcgggcgccgcgcccccggggg---------
A0A8C0JVF6_BCL2L1-      -----gtgatgtggaagagaacagaactgaggccccagaagggactgaat
A0A8C0JVF6_BCL2L1-      -----gtgatgtggaagagaacagaactgaggccccagaagggactgaat
A0A8C0K082_BCL2L2-      -----tgtttgtggag----------------------------------
A0A8C0K082_BCL2L2-      -----tgtttgtggag----------------------------------
A0A8C0L4C8_MCL1-01      ------------gggg----------------------------------
                                                                          

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      ---------------ccgcccccgcgccgggcatctccgcctcgcagccc
A0A8C0JVF6_BCL2L1-      cagagatggagacccccagtgccatcaatggcaacccatcctggcacttg
A0A8C0JVF6_BCL2L1-      cagagatggagacccccagtgccatcaatggcaacccatcctggcacttg
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
                                                                          

A0A8C0KQ53_BCL2A1-      ---------ccggcccccagcagagc------------------------
A0A8C0KWE3_BCL2-01      ggccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgc
A0A8C0JVF6_BCL2L1-      gcagacagccctgcggtgaatggagc-----------------------c
A0A8C0JVF6_BCL2L1-      gcagacagccctgcggtgaatggagc-----------------------c
A0A8C0K082_BCL2L2-      ---------ctggccctggagagggc-----------------------c
A0A8C0K082_BCL2L2-      ---------ctggccctggagagggc-----------------------c
A0A8C0L4C8_MCL1-01      ---------ccggcagcggcggcgcc-----------------------t
                                 *  **           *                        

A0A8C0KQ53_BCL2A1-      ----------------gtccagggtgctccaggacgtg--gccttctccg
A0A8C0KWE3_BCL2-01      ccccgccgccgccgccgccgccgccgccgcgggccccgcgcccagccccg
A0A8C0JVF6_BCL2L1-      actggccacagcagcagct--tggatgcccgggaggtg-----atcccca
A0A8C0JVF6_BCL2L1-      actggccacagcagcagct--tggatgcccgggaggtg-----atcccca
A0A8C0K082_BCL2L2-      c-----------agcagct----gatccactgcaccaa-----g---cca
A0A8C0K082_BCL2L2-      c-----------agcagct----gatccactgcaccaa-----g---cca
A0A8C0L4C8_MCL1-01      cctcttcgggagggcggcttttggcttcggggaaggag-----g---cca
                                        *              *               ** 

A0A8C0KQ53_BCL2A1-      t----------------------ccaggggcaggtggaaaagaacctg--
A0A8C0KWE3_BCL2-01      tgccacctgtggtccacctgaccctgcgccaggccggcgacgacttct--
A0A8C0JVF6_BCL2L1-      tggcagcggtga---aacaagcgctgagggaggctggggatgagtttg--
A0A8C0JVF6_BCL2L1-      tggcagcggtga---aacaagcgctgagggaggctggggatgagtttg--
A0A8C0K082_BCL2L2-      tgc------------------------gggcagctggagatgagtttg--
A0A8C0K082_BCL2L2-      tgc------------------------gggcagctggagatgagtttg--
A0A8C0L4C8_MCL1-01      cgaccagacggg---agggagggggaggggaagccggtgcggtgattggc
                                                   *    *  **    *        

A0A8C0KQ53_BCL2A1-      ----------aagccgtgcttggacagttttgac------gtggtgtctg
A0A8C0KWE3_BCL2-01      cccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctg
A0A8C0JVF6_BCL2L1-      aactgaggtaccggcgggcattcagtgacctgacatcccagcttcacatc
A0A8C0JVF6_BCL2L1-      aactgaggtaccggcgggcattcagtgacctgacatcccagcttcacatc
A0A8C0K082_BCL2L2-      agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtg
A0A8C0K082_BCL2L2-      agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtg
A0A8C0L4C8_MCL1-01      ggaagcg---ccggcgcaagtcccccgac----cactctggcgccggacg
                                    * **    *     *      *      *         

A0A8C0KQ53_BCL2A1-      tcgacacggccagaaccata----ttcaatc----------aggtgatgg
A0A8C0KWE3_BCL2-01      acgcccttcaccgcgaggggacgctttgcca----------cggtggtgg
A0A8C0JVF6_BCL2L1-      accccagggacagcatatcagagctttgagc----------aggtagtga
A0A8C0JVF6_BCL2L1-      accccagggacagcatatcagagctttgagc----------aggtagtga
A0A8C0K082_BCL2L2-      accccaggctcagcccagcaacgcttcaccc----------aggtctctg
A0A8C0K082_BCL2L2-      accccaggctcagcccagcaacgcttcaccc----------aggtctctg
A0A8C0L4C8_MCL1-01      cccggagggtc-gcgcggc----cctcacccattggcgctgagggcccca
                         *        * *            *                **      

A0A8C0KQ53_BCL2A1-      aga-------aggaatttgaagacggcgtcattaactggggaaggatcgt
A0A8C0KWE3_BCL2-01      agg-------agctcttcagggatggggtg---aactgggggaggatcgt
A0A8C0JVF6_BCL2L1-      atg-------aactcttccgggatggggtg---aactggggtcgcattgt
A0A8C0JVF6_BCL2L1-      atg-------aactcttccgggatggggtg---aactggggtcgcattgt
A0A8C0K082_BCL2L2-      acg-------aactcttccaagggggcccc---aactggggccgtcttgt
A0A8C0K082_BCL2L2-      acg-------aactcttccaagggggcccc---aactggggccgtcttgt
A0A8C0L4C8_MCL1-01      acgtcagcgcgacccccccgaggctgctgc---tgctcgcgcccccctgc
                        *                    *   *         ** * *       * 

A0A8C0KQ53_BCL2A1-      gac-cgtttttgcctttgaaggaatt----ctc-----------------
A0A8C0KWE3_BCL2-01      ggc-cttctttgagttcggtggggtc----atgtgtgtggagagcgtca-
A0A8C0JVF6_BCL2L1-      ggc-ctttttctccttcggtggggca----ctgtgcgtggagagcgtag-
A0A8C0JVF6_BCL2L1-      ggc-ctttttctccttcggtggggca----ctgtgcgtggagagcgtag-
A0A8C0K082_BCL2L2-      ggc-cttctttgtctttggagctgca----ctgtgtgctgagagtgtca-
A0A8C0K082_BCL2L2-      ggc-cttctttgtctttggagctgca----ctgtgtgctgagagtgtca-
A0A8C0L4C8_MCL1-01      cgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
                          * * *       *     *                             

A0A8C0KQ53_BCL2A1-      -----accaagaaact--------------------cctcgagcagcgaa
A0A8C0KWE3_BCL2-01      -----accgggagatg---------------tcgcccctggtggacaaca
A0A8C0JVF6_BCL2L1-      -----acaaggagatg---------------caggtattggtgagtcgga
A0A8C0JVF6_BCL2L1-      -----acaaggagatg---------------caggtattggtgagtcgga
A0A8C0K082_BCL2L2-      -----acaaagagatg------------gagcc---acttgtgggacaag
A0A8C0K082_BCL2L2-      -----acaaagagatg------------gagcc---acttgtgggacaag
A0A8C0L4C8_MCL1-01      gtcgcccgaagaggagctagacgggtacgagccggaacctttgggg-aag
                              *   **                              *       

A0A8C0KQ53_BCL2A1-      ---------------tttcctcggatgtggatgccgagaag-----gttt
A0A8C0KWE3_BCL2-01      -------------------tcgccctgtggatg-------------actg
A0A8C0JVF6_BCL2L1-      -------------------tcgcagcttggatg-------------gcca
A0A8C0JVF6_BCL2L1-      -------------------tcgcagcttggatg-------------gcca
A0A8C0K082_BCL2L2-      -------------------tgcaagagtggatg-------------gtgg
A0A8C0K082_BCL2L2-      -------------------tgcaagagtggatg-------------gtgg
A0A8C0L4C8_MCL1-01      cggccggcggtcctgcctctgctggagttggtgggggaggccagcagtgg
                                                   * * **                 

A0A8C0KQ53_BCL2A1-      cctacttcgtggcagagttcatcacgagaaacatgagagactggataaga
A0A8C0KWE3_BCL2-01      agtacctgaaccggcatct---------gcacac------ctggatccag
A0A8C0JVF6_BCL2L1-      cttacctgaatgaccacct---------agagcc------ttggatccag
A0A8C0JVF6_BCL2L1-      cttacctgaatgaccacct---------agagcc------ttggatccag
A0A8C0K082_BCL2L2-      cctacctggagacacggct---------ggc------cgactggatccac
A0A8C0K082_BCL2L2-      cctacctggagacacggct---------ggc------cgactggatccac
A0A8C0L4C8_MCL1-01      cc--ccggcatggacggct---------cgctaccctcgacgccaccccc
                            *             *                         *     

A0A8C0KQ53_BCL2A1-      caaaacggaggctgggaaaacggctttg-------------tgaag----
A0A8C0KWE3_BCL2-01      gacaacggaggctgggat---gcctttg-------------tggaactg-
A0A8C0JVF6_BCL2L1-      gagaacggcggctgggat---acttttg-------------tggaactc-
A0A8C0JVF6_BCL2L1-      gagaacggcggctgggat---acttttg-------------tggaactc-
A0A8C0K082_BCL2L2-      agcagtgggggctggg-------------------------cggagttca
A0A8C0K082_BCL2L2-      agcagtgggggctggg-------------------------cggagttca
A0A8C0L4C8_MCL1-01      ggcggaggaggaggaaga---tgagttgtaccggcagtccctggagatta
                              ** **  *                            * *     

A0A8C0KQ53_BCL2A1-      ---------aagttcgaacccaagtct---------ggatggct------
A0A8C0KWE3_BCL2-01      --------ta----cggcccca------------ccatgcagcc------
A0A8C0JVF6_BCL2L1-      --------ta----cgggaaca--------------atgcagca------
A0A8C0JVF6_BCL2L1-      --------ta----cgggaaca--------------atgcagca------
A0A8C0K082_BCL2L2-      cagctctata----cggggacggggccctgg-----aggaggcg------
A0A8C0K082_BCL2L2-      cagctctata----cggggacggggccctgg-----aggaggcg------
A0A8C0L4C8_MCL1-01      tctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaacca
                                 *    **    *                    **       

A0A8C0KQ53_BCL2A1-      -------------------------------------gacttttctggaa
A0A8C0KWE3_BCL2-01      -----------------------------tctgtttgacttctcctggct
A0A8C0JVF6_BCL2L1-      ----------------------------------------------gccg
A0A8C0JVF6_BCL2L1-      ----------------------------------------------gccg
A0A8C0K082_BCL2L2-      ---------------------------------------------cggcg
A0A8C0K082_BCL2L2-      ---------------------------------------------cggcg
A0A8C0L4C8_MCL1-01      ctgggcgggtctcgggcggccagccggaaggcgttagagaccctccggcg
                                                                      *   

A0A8C0KQ53_BCL2A1-      gttctgggaacag-----------------------------------tg
A0A8C0KWE3_BCL2-01      gtctctgaaggcg------------------------------------c
A0A8C0JVF6_BCL2L1-      agagccggaaggg---------------------------ccaggagcgc
A0A8C0JVF6_BCL2L1-      agagccggaaggg---------------------------ccaggagcgc
A0A8C0K082_BCL2L2-      tctgcgggagggg-------------------------------------
A0A8C0K082_BCL2L2-      tctgcgggagggg-------------------------------------
A0A8C0L4C8_MCL1-01      agtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgc
                              * *   *                                     

A0A8C0KQ53_BCL2A1-      tgtgaaatgtggtcacacc-------------------------------
A0A8C0KWE3_BCL2-01      tgctcagtctggccc-----------------------------------
A0A8C0JVF6_BCL2L1-      ttcaaccgctggttcctgacaggcatgactgtggc---------------
A0A8C0JVF6_BCL2L1-      ttcaaccgctggttcctgacaggcatgactgtggc---------------
A0A8C0K082_BCL2L2-      ------aactgggcctc---agtgaggacagtgc----------------
A0A8C0K082_BCL2L2-      ------aactgggcctc---agtgaggacagtgc----------------
A0A8C0L4C8_MCL1-01      ttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcga
                                 ***                                      

A0A8C0KQ53_BCL2A1-      --------------------taaagcaa----------------------
A0A8C0KWE3_BCL2-01      --------------------tggtggga----------------------
A0A8C0JVF6_BCL2L1-      --------------------tggcgtgg----------------------
A0A8C0JVF6_BCL2L1-      --------------------tggcgtgg----------------------
A0A8C0K082_BCL2L2-      --------------------tgacgggg------gccgtggca-------
A0A8C0K082_BCL2L2-      --------------------tgacgggg------gccgtggca-------
A0A8C0L4C8_MCL1-01      gtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgt
                                            *   *                         

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      -gcttgcatcaccctgggtgcct---------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0K082_BCL2L2-      -------------ctgggggccctggtcacc-------------------
A0A8C0K082_BCL2L2-      -------------ctgggggccctggtcacc-------------------
A0A8C0L4C8_MCL1-01      gactcttatttcctttggtgcctttgtggccaaacacttgaagagtataa
                                                                          

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0L4C8_MCL1-01      accaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctc
                                                                          

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0K082_BCL2L2-      --------------------------------------------------
A0A8C0L4C8_MCL1-01      gtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtt
                                                                          

A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0JVF6_BCL2L1-      --------------------------------------------------
A0A8C0K082_BCL2L2-      ----------------gtaggggcctt-----------------------
A0A8C0K082_BCL2L2-      ----------------gtaggggcctt-----------------------
A0A8C0L4C8_MCL1-01      tgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgc
                                                                          

A0A8C0KQ53_BCL2A1-      -------tactactga----------------------------------
A0A8C0KWE3_BCL2-01      -------atctg---------------ggccataagtga-----------
A0A8C0JVF6_BCL2L1-      -------ttctgctgggctcgctcttcagtcggaaatga-----------
A0A8C0JVF6_BCL2L1-      -------ttctgctgggctcgctcttcagtcggaaatga-----------
A0A8C0K082_BCL2L2-      -------ttttgc-----------g--agcaagtga--------------
A0A8C0K082_BCL2L2-      -------ttttgc-----------g--agcaagtga--------------
A0A8C0L4C8_MCL1-01      tgctggcttttgcaggtgttgctgg--agtaggagctggtttggcatatc
                                  *                                       

A0A8C0KQ53_BCL2A1-      -----------
A0A8C0KWE3_BCL2-01      -----------
A0A8C0JVF6_BCL2L1-      -----------
A0A8C0JVF6_BCL2L1-      -----------
A0A8C0K082_BCL2L2-      -----------
A0A8C0K082_BCL2L2-      -----------
A0A8C0L4C8_MCL1-01      taataagatag
                                   

© 1998-2022Legal notice