Dataset for CDS BCL-2-like of organism Canis lupus dingo

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C0KQ53_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus dingo GN=BCL2A1 (length=525 residues).
atgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccgg
cccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagc
cgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaa
gacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcg
aatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataa
gacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctg
ggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8C0KWE3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus dingo GN=BCL-2 (length=714 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgccgccgccgccgccgccgccgccgcg
ggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccg
ccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggagg
agctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggat
ccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgt
ctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0L4C8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus dingo GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2023Legal notice