Dataset for CDS BCL-2-like of organism Anabas testudineus

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=852 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=867 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagtgctgtccgacttcagcctcttcacctgcattaa
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1IAB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L10 (length=732 residues).
atgttccaactctcatggggactttttcttctggaggcggagtcagcggataaatgtgcggacgctgaggggaaactgcg
agtgcaccgaggatctccttccgccgtccgtatgtgcagagagcagactgatatcgctgggaggaaaatgtcgtgtgggc
tgtggaaagacaccctggctctggcagaggactacctgtccctgtgctgcaccagcccttggccagcccctccacctccc
agcgagtcagccgctgccatgagacgtctggcccaggacatggagaagcagcatcaggttcgcttccactccctagctca
gactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggtgatggaggagctggtgggagatggacaca
tgaactgggggagggttgtttcccttttcaccttcactggggtgctggccagacagatgctggagcagaaggacaagaag
ccggggctggaccttgggaaggggcaggaactaggacaggagcctggacaatgtaggggactggcagagaccatagctga
ttacctgggagaagagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctcctgcagtgcca
gagaagtgagccaggactcctccatgaagagagcgctgtttgctgctgctggtgtgggtcttgcgggactcaccttcctc
ctggtgcgctag
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgcgtgggggtt
tcatgatgcccaagacgaagatgctgctaataatgggtctgcagttccccctccaccgactttggtccggcggtgccgtg
aagccagcaccgggcctgacagcgacagcatcccgcaacactgcagacggctccctccgtccgacccgcacgctgcgctc
cacagggtcctgcgtgaggctggagatgaacttgaaagactatatcagccggacttcacggagatgtcccgacagctgta
tctcacctccaccacggcgcagcggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcgtccaaggaggagatgacaccgcaggtgaacaac
atcgcagagtggatgacggagtatttaaatggacctcttcacagctggatacaagataacgggggatgggatgccttcgt
ggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggcctcgctgctc
tcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1017 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagg
atgccttcgtggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggc
ctcgctgctctcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1302 residues).
atgcagactgctttgtcacggggagaaagggttcaacacggtactttaatccgactgttgcacatctttgactctctgcc
aaaccagcgaacaactcctcctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcgtatctcggtt
atcgaacccctgaagctggcctgctagttagcagacgagctaacgattgtcagatttcacccatgtcctctgaagaaggg
ttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcattatgcttcttgtaattgc
tgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacctctgaaactgaacgggg
cccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctacagacaaggagcattcatc
actttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgccatcaatgacaaacaggt
ggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgg
gacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtggaggtggattgttttaaa
aaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatggg
ccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactccccatccaagtttgccc
tgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtggcctacccccccgacact
gacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtca
accagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttaca
tgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggatta
tttcgaaccattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaa
agcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=954 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
gcactttactccagattccactattgcaaaatgttggccttattttcaccagaaactgatggaagtgaactacctgggca
gcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagca
ggacaggttggcctgtttggatacactgcctactccccatccaagtttgccctgcgtggtttagcagagtcactgcagat
ggagataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttggctgaggaaaata
agacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggccaaaatcattgtg
cgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctcacctgtggaatgtc
acccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgccctgttctacttgg
ggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=894 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcaataattaccatgggattatttcgaac
cattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctg
acaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=807 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttg
gctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctca
cctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgcc
ctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagag
agagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcat
tatgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctac
agacaaggagcattcatcactttagtggcacgaaatgaggtggtgctttgcatatcagtggatgtttccagtgattatag
tcaggtggaaagtgtgataaaacaggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaa
tgtctggaaagtttgaggaggtggaggtggattgttttaaaataattaccatgggattatttcgaaccattgccctgttc
tacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagta
a
© 1998-2022Legal notice