Dataset for CDS BCL-2-like of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1I5N1_BCL2-01      atggc------------------------------------------gaa
A0A3Q1IAB0_BCL2L10      atgttccaactctcatggggactttttcttctggaggcg--------gag
A0A3Q1GZ93_BCL2L1-      atg--------------------tctcaaa------acaga------gaa
A0A3Q1GZ93_BCL2L1-      atg--------------------tctcaaa------acaga------gaa
A0A3Q1GZ93_BCL2L1-      atg--------------------tctcaaa------acaga------gaa
A0A3Q1JZ46_BCL2L1-      atg-------------gaagaaatgtcgaac-agtaacaga------gag
A0A3Q1JZ46_BCL2L1-      atg-------------gaagaaatgtcgaac-agtaacaga------gag
A0A3Q1GX28_MCL1-02      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag
A0A3Q1GX28_MCL1-01      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag
                        ***                                            ** 

A0A3Q1I5N1_BCL2-01      cgagtgtaa------tcgcaatattgtagaaaagtatatctgcca---ta
A0A3Q1IAB0_BCL2L10      tcagcggat---------aaatgtg-------------------------
A0A3Q1GZ93_BCL2L1-      ctggtggtt--ttctacataacata-----------------------ta
A0A3Q1GZ93_BCL2L1-      ctggtggtt--ttctacataacata-----------------------ta
A0A3Q1GZ93_BCL2L1-      ctggtggtt--ttctacataacata-----------------------ta
A0A3Q1JZ46_BCL2L1-      ctggtggag--ttcttcataatgta-----------------------ca
A0A3Q1JZ46_BCL2L1-      ctggtggag--ttcttcataatgta-----------------------ca
A0A3Q1GX28_MCL1-02      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca
A0A3Q1GX28_MCL1-01      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca

A0A3Q1I5N1_BCL2-01      aactctccaaac--------------------------------------
A0A3Q1IAB0_BCL2L10      --------cgga-------------------------------------c
A0A3Q1GZ93_BCL2L1-      aactatcccaga--------------------------------------
A0A3Q1GZ93_BCL2L1-      aactatcccaga--------------------------------------
A0A3Q1GZ93_BCL2L1-      aactatcccaga--------------------------------------
A0A3Q1JZ46_BCL2L1-      aactgtctcaaa--------------------------------------
A0A3Q1JZ46_BCL2L1-      aactgtctcaaa--------------------------------------
A0A3Q1GX28_MCL1-02      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat
A0A3Q1GX28_MCL1-01      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat

A0A3Q1I5N1_BCL2-01      --------ggggctacgcgtggg-----------ggtttcatgatgccca
A0A3Q1IAB0_BCL2L10      gctgaggggaaactgcgagtgcaccgaggatctccttccgccgtccgtat
A0A3Q1GZ93_BCL2L1-      --------gaaactatcc----------------tctcaaccacttgg-g
A0A3Q1GZ93_BCL2L1-      --------gaaactatcc----------------tctcaaccacttgg-g
A0A3Q1GZ93_BCL2L1-      --------gaaactatcc----------------tctcaaccacttgg-g
A0A3Q1JZ46_BCL2L1-      --------gaaaccaccc---agcct---------ctcttctga-ggc-c
A0A3Q1JZ46_BCL2L1-      --------gaaaccaccc---agcct---------ctcttctga-ggc-c
A0A3Q1GX28_MCL1-02      gctgctctgaaacgacccaagaacctggacgtgagctcatcgaatggc-t
A0A3Q1GX28_MCL1-01      gctgctctgaaacgacccaagaacctggacgtgagctcatcgaatggc-t
                                *   *                       *             

A0A3Q1I5N1_BCL2-01      agacgaagat----------gctgctaataatgggtctgcagttccccct
A0A3Q1IAB0_BCL2L10      gtgcagagagcag-------actgatatcgctgggaggaaaatgtc----
A0A3Q1GZ93_BCL2L1-      actcaatgagactccc----aacaggactgatgggggggaag--------
A0A3Q1GZ93_BCL2L1-      actcaatgagactccc----aacaggactgatgggggggaag--------
A0A3Q1GZ93_BCL2L1-      actcaatgagactccc----aacaggactgatgggggggaag--------
A0A3Q1JZ46_BCL2L1-      a-------------------gatgataccggtggagtgggag--------
A0A3Q1JZ46_BCL2L1-      a-------------------gatgataccggtggagtgggag--------
A0A3Q1GX28_MCL1-02      atgcaacaaaaaacattggggctaacagcgacgacatcgaag--------
A0A3Q1GX28_MCL1-01      atgcaacaaaaaacattggggctaacagcgacgacatcgaag--------
                                                  *     *       *         

A0A3Q1I5N1_BCL2-01      ccaccgactttggtccggcggtgccgtgaagccagcaccgggcctgacag
A0A3Q1IAB0_BCL2L10      gtgtgggctgtggaaagac---accctggctctggcagaggactacctgt
A0A3Q1GZ93_BCL2L1-      --atgggtt---------g---agtgaggaacag----cggatagcaa--
A0A3Q1GZ93_BCL2L1-      --atgggtt---------g---agtgaggaacag----cggatagcaa--
A0A3Q1GZ93_BCL2L1-      --atgggtt---------g---agtgaggaacag----cggatagcaa--
A0A3Q1JZ46_BCL2L1-      --acagaccc--------a---actcagcagctgctaacgg---------
A0A3Q1JZ46_BCL2L1-      --acagaccc--------a---actcagcagctgctaacgg---------
A0A3Q1GX28_MCL1-02      --acggatctttgccgtgc---accccggagctgatgtcggacagcgagg
A0A3Q1GX28_MCL1-01      --acggatctttgccgtgc---accccggagctgatgtcggacagcgagg
                             *                     *   *       **         

A0A3Q1I5N1_BCL2-01      cgacagcatcccgcaacactgcaga-------------------------
A0A3Q1IAB0_BCL2L10      c--------cctgtgctgcaccagcccttggccag------------ccc
A0A3Q1GZ93_BCL2L1-      -----------cgcacgccaacgggacttttaatggtagaag-----tcc
A0A3Q1GZ93_BCL2L1-      -----------cgcacgccaacgggacttttaatggtagaag-----tcc
A0A3Q1GZ93_BCL2L1-      -----------cgcacgccaacgggacttttaatggtagaag-----tcc
A0A3Q1JZ46_BCL2L1-      ---------cctgccggtcagcaggag-tggcgagctgggga-----act
A0A3Q1JZ46_BCL2L1-      ---------cctgccggtcagcaggag-tggcgagctgggga-----act
A0A3Q1GX28_MCL1-02      tcgatgtctccagttgtccagcaggggacgaggtgctggagaacgacacg
A0A3Q1GX28_MCL1-01      tcgatgtctccagttgtccagcaggggacgaggtgctggagaacgacacg
                                    *     *  * *                          

A0A3Q1I5N1_BCL2-01      cggctccctc----------------------------------------
A0A3Q1IAB0_BCL2L10      ctccacctcc----------------------------------------
A0A3Q1GZ93_BCL2L1-      cgggaccccc----ccagcgtccccg------ctgcggcaacaacggttg
A0A3Q1GZ93_BCL2L1-      cgggaccccc----ccagcgtccccg------ctgcggcaacaacggttg
A0A3Q1GZ93_BCL2L1-      cgggaccccc----ccagcgtccccg------ctgcggcaacaacggttg
A0A3Q1JZ46_BCL2L1-      cgtcacctcc----------------------------------------
A0A3Q1JZ46_BCL2L1-      cgtcacctcc----------------------------------------
A0A3Q1GX28_MCL1-02      aggcagctcctaagccagtttctccaagacttttctggacttactaagcc
A0A3Q1GX28_MCL1-01      aggcagctcctaagccagtttctccaagacttttctggacttactaagcc
                              *  *                                        

A0A3Q1I5N1_BCL2-01      -------cgtccgacccgcacgc----tgcgctccacagggtcctgcgtg
A0A3Q1IAB0_BCL2L10      ----cagcgagtcagccgc--------tgccatgagacgtctggcccagg
A0A3Q1GZ93_BCL2L1-      ccatcaacg-acgagcctgga------tgcggtgaaagaggccctccggg
A0A3Q1GZ93_BCL2L1-      ccatcaacg-acgagcctgga------tgcggtgaaagaggccctccggg
A0A3Q1GZ93_BCL2L1-      ccatcaacg-acgagcctgga------tgcggtgaaagaggccctccggg
A0A3Q1JZ46_BCL2L1-      ------gtgtaagagcatgga------ggccgtaaaaacagctcttaggg
A0A3Q1JZ46_BCL2L1-      ------gtgtaagagcatgga------ggccgtaaaaacagctcttaggg
A0A3Q1GX28_MCL1-02      tcgttggtgtgaaaccaaagaactatcaacaatgaaaagggttgtgaatg
A0A3Q1GX28_MCL1-01      tcgttggtgtgaaaccaaagaactatcaacaatgaaaagggttgtgaatg
                                *    * *             *  *                *

A0A3Q1I5N1_BCL2-01      aggctggagatgaacttgaaagactatatcagccggact----tcacgga
A0A3Q1IAB0_BCL2L10      acatggagaagcagc---atcaggttcgcttccactccctagctca--ga
A0A3Q1GZ93_BCL2L1-      actcggccaacgagtttgagttacgatacgctcgagcct----tcagcga
A0A3Q1GZ93_BCL2L1-      actcggccaacgagtttgagttacgatacgctcgagcct----tcagcga
A0A3Q1GZ93_BCL2L1-      actcggccaacgagtttgagttacgatacgctcgagcct----tcagcga
A0A3Q1JZ46_BCL2L1-      actctgctgacgagtttgaactgctcttcacacaagcgt----ttagtga
A0A3Q1JZ46_BCL2L1-      actctgctgacgagtttgaactgctcttcacacaagcgt----ttagtga
A0A3Q1GX28_MCL1-02      acgttctggaaaaac----acagatacgcgtacaatggtatgatcaacaa
A0A3Q1GX28_MCL1-01      acgttctggaaaaac----acagatacgcgtacaatggtatgatcaacaa
                        *        *  *                   *          * *   *

A0A3Q1I5N1_BCL2-01      gatgtcccgacagctgtatctcacctccaccacggcgcagcggagattcg
A0A3Q1IAB0_BCL2L10      ctttcctgaagcagtgcgggccggacc--------cctgctccagcctca
A0A3Q1GZ93_BCL2L1-      tctgcacaaccagctgcatatcacgcctgccacagcctaccaaagcttcg
A0A3Q1GZ93_BCL2L1-      tctgcacaaccagctgcatatcacgcctgccacagcctaccaaagcttcg
A0A3Q1GZ93_BCL2L1-      tctgcacaaccagctgcatatcacgcctgccacagcctaccaaagcttcg
A0A3Q1JZ46_BCL2L1-      cctttcctcgcagcttgatgtcacgcccgacacggcctatcaaagcttta
A0A3Q1JZ46_BCL2L1-      cctttcctcgcagcttgatgtcacgcccgacacggcctatcaaagcttta
A0A3Q1GX28_MCL1-02      actctc------actggatgaca------aagtggacgatgtgagtttta
A0A3Q1GX28_MCL1-01      actctc------actggatgaca------aagtggacgatgtgagtttta
                          *           *      *                     **  *  

A0A3Q1I5N1_BCL2-01      ccgaggtgatagacgaa---ctgttccgggacggggtg---aactggggc
A0A3Q1IAB0_BCL2L10      ggaaggtgatggaggag---ctggtgggagatggacacatgaactggggg
A0A3Q1GZ93_BCL2L1-      agaacgtcatggatgaa---gtgttccgggacggtgtc---aactggggc
A0A3Q1GZ93_BCL2L1-      agaacgtcatggatgaa---gtgttccgggacggtgtc---aactggggc
A0A3Q1GZ93_BCL2L1-      agaacgtcatggatgaa---gtgttccgggacggtgtc---aactggggc
A0A3Q1JZ46_BCL2L1-      agagtgtgatggacgag---ttgttcaaggatggagtc---aactgggga
A0A3Q1JZ46_BCL2L1-      agagtgtgatggacgag---ttgttcaaggatggagtc---aactgggga
A0A3Q1GX28_MCL1-02      tcacggcagtagcccagagccttttctcagatggaaccacaaactggggt
A0A3Q1GX28_MCL1-01      tcacggcagtagcccagagccttttctcagatggaaccacaaactggggt
                             *   * *   *     *  *    ** **       ******** 

A0A3Q1I5N1_BCL2-01      cggattatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgc
A0A3Q1IAB0_BCL2L10      agggttgtttcccttttcaccttcactggggtgctggccagacagatgct
A0A3Q1GZ93_BCL2L1-      cgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgt
A0A3Q1GZ93_BCL2L1-      cgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgt
A0A3Q1GZ93_BCL2L1-      cgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgt
A0A3Q1JZ46_BCL2L1-      cgtatagtggggctgtttgccttcggtggcgtgctgtgtgtggaatgtgt
A0A3Q1JZ46_BCL2L1-      cgtatagtggggctgtttgccttcggtggcgtgctgtgtgtggaatgtgt
A0A3Q1GX28_MCL1-02      cgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaa
A0A3Q1GX28_MCL1-01      cgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaa
                         *  *        *  *    **    *      **       *      

A0A3Q1I5N1_BCL2-01      gtccaaggaggagatgacaccgcag-g---------tgaacaaca-----
A0A3Q1IAB0_BCL2L10      g---gagcagaaggacaagaagccggggctggaccttgggaaggggcagg
A0A3Q1GZ93_BCL2L1-      g---gagaaggagatgagtcagctg-g---------tgggaagga-----
A0A3Q1GZ93_BCL2L1-      g---gagaaggagatgagtcagctg-g---------tgggaagga-----
A0A3Q1GZ93_BCL2L1-      g---gagaaggagatgagtcagctg-g---------tgggaagga-----
A0A3Q1JZ46_BCL2L1-      g---gagaagaatatgagtgagctg-g---------tatcccgaa-----
A0A3Q1JZ46_BCL2L1-      g---gagaagaatatgagtgagctg-g---------tatcccgaa-----
A0A3Q1GX28_MCL1-02      g---gaaaaacaca-gggagaactgtg---------tggatctgg-----
A0A3Q1GX28_MCL1-01      g---gaaaaacaca-gggagaactgtg---------tggatctgg-----
                        *    *  *  *          * * *         *             

A0A3Q1I5N1_BCL2-01      ---------------------------------tcgcagagtggatgacg
A0A3Q1IAB0_BCL2L10      aactaggacaggagcctggacaatgtaggggactggcagagaccatagct
A0A3Q1GZ93_BCL2L1-      ---------------------------------tcgtagagtggatgaca
A0A3Q1GZ93_BCL2L1-      ---------------------------------tcgtagagtggatgaca
A0A3Q1GZ93_BCL2L1-      ---------------------------------tcgtagagtggatgaca
A0A3Q1JZ46_BCL2L1-      ---------------------------------tcgcagactggatgacc
A0A3Q1JZ46_BCL2L1-      ---------------------------------tcgcagactggatgacc
A0A3Q1GX28_MCL1-02      ---------------------------------tggcacaggagatctcc
A0A3Q1GX28_MCL1-01      ---------------------------------tggcacaggagatctcc
                                                         * * * *    **  * 

A0A3Q1I5N1_BCL2-01      gagtatttaaatggacctcttcacagctggatacaagataacggggg---
A0A3Q1IAB0_BCL2L10      gattacctgggagaagaga-------agaaagactggctgctggagaatg
A0A3Q1GZ93_BCL2L1-      gtctacctggacaaccacattcagccctggatccaa---agccaaggagg
A0A3Q1GZ93_BCL2L1-      gtctacctggacaaccacattcagccctggatccaa---agccaaggagg
A0A3Q1GZ93_BCL2L1-      gtctacctggacaaccacattcagccctggatccaa---agccaaggagg
A0A3Q1JZ46_BCL2L1-      atgtacctggatgagcacatcagtccttggatccag---agccagggagg
A0A3Q1JZ46_BCL2L1-      atgtacctggatgagcacatcagtccttggatccag---agccagggagg
A0A3Q1GX28_MCL1-02      tcatacctg-------ctgtcagcccagcgagactggctggtcaggaaca
A0A3Q1GX28_MCL1-01      tcatacctg-------ctgtcagcccagcgagactggctggtcaggaaca
                           **  *                      *  *           *    

A0A3Q1I5N1_BCL2-01      ----atgggatgccttcgtggacctgtatgacagacagagggagtctgtg
A0A3Q1IAB0_BCL2L10      atggatgggaggggttctgtaagttctcc--------t------------
A0A3Q1GZ93_BCL2L1-      ----atgggagcgctttgctgagctcttcggccacgac------------
A0A3Q1GZ93_BCL2L1-      ----atgggagcgctttgctgagctcttcggccacgac------------
A0A3Q1GZ93_BCL2L1-      ----atgggagcgctttgctgagctcttcggccacgac------------
A0A3Q1JZ46_BCL2L1-      ----atgggactgctttgctgagatatttgggcaagat------------
A0A3Q1JZ46_BCL2L1-      ----atgggactgctttgctgagatatttgggcaagat------------
A0A3Q1GX28_MCL1-02      actcatgggatggttttgttgaattcttt---cgagtg------------
A0A3Q1GX28_MCL1-01      actcatgggatggttttgttgaattcttt---cgagtg------------
                            ******    **     *  * *                       

A0A3Q1I5N1_BCL2-01      ttcagttgctcctggtcctccatcaagacggtctt-------------cg
A0A3Q1IAB0_BCL2L10      ----gcagtgccagagaagtgagccaggactcctc--------catgaag
A0A3Q1GZ93_BCL2L1-      ----gcagcagcaga------gggcaggcggtctcaggagagtttca-ag
A0A3Q1GZ93_BCL2L1-      ----gcagcagcaga------gggcaggcggtctcaggagagtttca-ag
A0A3Q1GZ93_BCL2L1-      ----gcagcagcaga------gggcaggcggtctcaggagagtttca-ag
A0A3Q1JZ46_BCL2L1-      ----gccgctgctga------ggcgaggagatctcgggaggctctgagaa
A0A3Q1JZ46_BCL2L1-      ----gccgctgctga------ggcgaggagatctcgggaggctctgagaa
A0A3Q1GX28_MCL1-02      ----gcagaccctgaatccacagtgaggaaatcactcatggcctttgcag
A0A3Q1GX28_MCL1-01      ----gcagaccctgaatccacagtgaggaaatcactcatggcctttgcag
                            *  *   * *           **     *                 

A0A3Q1I5N1_BCL2-01      gcctcgctgctctcggggc---agccagcctcaccattggagctta----
A0A3Q1IAB0_BCL2L10      agagcgctgtt-------------tgctgctgctggtgtggg--tcttgc
A0A3Q1GZ93_BCL2L1-      aagtggctgctggcagg-----catgaccctggtgactgggg--tcgtgg
A0A3Q1GZ93_BCL2L1-      aagtggctgctggcagg-----catgaccctggtgactgggg--tcgtgg
A0A3Q1GZ93_BCL2L1-      aagtggctgctggcagg-----catgaccctggtgactgggg--tcgtgg
A0A3Q1JZ46_BCL2L1-      ga-tggctgctagttgg-----agtggtgctgctcacgggag--tgctgt
A0A3Q1JZ46_BCL2L1-      ga-tggctgctagttgg-----agtggtgctgctcacgggag--tgctgt
A0A3Q1GX28_MCL1-02      gattggctggtattggggcatcactggccctgttgatcag----tgctgt
A0A3Q1GX28_MCL1-01      gattggctggtattggggcatcactggccctgttgatcagctcctgtagt
                             **** *                  **        *    *     

A0A3Q1I5N1_BCL2-01      ----------ccttgcacagaaatg------a
A0A3Q1IAB0_BCL2L10      gggactcac-cttcctcctggtgcg---ctag
A0A3Q1GZ93_BCL2L1-      tggggtcactcatagcgcagaaacgcctgtga
A0A3Q1GZ93_BCL2L1-      tggggtcactcatagcgcagaaacgcctgtga
A0A3Q1GZ93_BCL2L1-      tggggtcactcatagcgcagaaacgcctgtga
A0A3Q1JZ46_BCL2L1-      taggtgtgctcattgctaagaaacg---gtga
A0A3Q1JZ46_BCL2L1-      taggtgtgctcattgctaagaaacg---gtga
A0A3Q1GX28_MCL1-02      ccgacttcagcctc-ttcacctgca---ttaa
A0A3Q1GX28_MCL1-01      gtgatgtga-----------------------

© 1998-2020Legal notice