Dataset for CDS BCL-2-like of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1IAB0_BCL2L10      atgttccaactctcatggggactttttcttctggaggcg--------gag
A0A3Q1GZ93_BCL2L1-      atg--------------------tctcaaa------acaga------gaa
A0A3Q1JZ46_BCL2L1-      atg-------------gaagaaatgtcgaac-agtaacaga------gag
A0A3Q1GX28_MCL1-01      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag
A0A3Q1GX28_MCL1-02      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag
                        ***                    * *           *         ** 

A0A3Q1IAB0_BCL2L10      tcagcggat---------aaatgtg-------------------------
A0A3Q1GZ93_BCL2L1-      ctggtggtt--ttctacataacata-----------------------ta
A0A3Q1JZ46_BCL2L1-      ctggtggag--ttcttcataatgta-----------------------ca
A0A3Q1GX28_MCL1-01      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca
A0A3Q1GX28_MCL1-02      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca
                              *            **                             

A0A3Q1IAB0_BCL2L10      --------cgga-------------------------------------c
A0A3Q1GZ93_BCL2L1-      aactatcccaga--------------------------------------
A0A3Q1JZ46_BCL2L1-      aactgtctcaaa--------------------------------------
A0A3Q1GX28_MCL1-01      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat
A0A3Q1GX28_MCL1-02      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat
                                *  *                                      

A0A3Q1IAB0_BCL2L10      gctgaggggaaactgcgagtgcaccgaggatct----------ccttccg
A0A3Q1GZ93_BCL2L1-      --------gaaactat-------cc----------------tctcaacca
A0A3Q1JZ46_BCL2L1-      --------gaaaccac-------cc---agcct---------ctcttctg
A0A3Q1GX28_MCL1-01      gctgctctgaaacgac-------ccaagaacctggacgtgagctcatcga
A0A3Q1GX28_MCL1-02      gctgctctgaaacgac-------ccaagaacctggacgtgagctcatcga
                                *****          **                   *  *  

A0A3Q1IAB0_BCL2L10      ccgtccgtatgtgcagagagca---gactgatatcgctgggaggaaaatg
A0A3Q1GZ93_BCL2L1-      cttgggactcaatgagactccc----aacaggactgatgggggggaag--
A0A3Q1JZ46_BCL2L1-      a-ggcca-------------------gatgataccggtggagtgggag--
A0A3Q1GX28_MCL1-01      atggctatgcaacaaaaaacattggggctaacagcgacgacatcgaag--
A0A3Q1GX28_MCL1-02      atggctatgcaacaaaaaacattggggctaacagcgacgacatcgaag--
                                                        *  *  *       *   

A0A3Q1IAB0_BCL2L10      tcgtgtgggctgtggaaagacaccctggctctggcagaggactacctgtc
A0A3Q1GZ93_BCL2L1-      ----atgggtt---------gagtgaggaacag----cggatagcaa---
A0A3Q1JZ46_BCL2L1-      ----acagaccc--------aactcagcagctgctaacgg----------
A0A3Q1GX28_MCL1-01      ----acggatctttgccgtgcaccccggagctgatgtcggacagcgaggt
A0A3Q1GX28_MCL1-02      ----acggatctttgccgtgcaccccggagctgatgtcggacagcgaggt
                               *             *    *   * *     **          

A0A3Q1IAB0_BCL2L10      --------cctgtgctgcaccagcccttggccag------------cccc
A0A3Q1GZ93_BCL2L1-      ----------cgcacgccaacgggacttttaatggtagaag-----tccc
A0A3Q1JZ46_BCL2L1-      --------cctgccggtcagcaggag-tggcgagctgggga-----actc
A0A3Q1GX28_MCL1-01      cgatgtctccagttgtccagcaggggacgaggtgctggagaacgacacga
A0A3Q1GX28_MCL1-02      cgatgtctccagttgtccagcaggggacgaggtgctggagaacgacacga
                                   *     ** * *          *             *  

A0A3Q1IAB0_BCL2L10      tccacctcc-----------------------------------------
A0A3Q1GZ93_BCL2L1-      gggaccccc----ccagcgtccccg------ctgcggcaacaacggttgc
A0A3Q1JZ46_BCL2L1-      gtcacctcc-----------------------------------------
A0A3Q1GX28_MCL1-01      ggcagctcctaagccagtttctccaagacttttctggacttactaagcct
A0A3Q1GX28_MCL1-02      ggcagctcctaagccagtttctccaagacttttctggacttactaagcct
                           * * **                                         

A0A3Q1IAB0_BCL2L10      ---cagcgagtcagccgc--------tgccatgagacgtctggcccagga
A0A3Q1GZ93_BCL2L1-      catcaacg-acgagcctgga------tgcggtgaaagaggccctccggga
A0A3Q1JZ46_BCL2L1-      -----gtgtaagagcatgga------ggccgtaaaaacagctcttaggga
A0A3Q1GX28_MCL1-01      cgttggtgtgaaaccaaagaactatcaacaatgaaaagggttgtgaatga
A0A3Q1GX28_MCL1-02      cgttggtgtgaaaccaaagaactatcaacaatgaaaagggttgtgaatga
                               *    * *             *  * * *            **

A0A3Q1IAB0_BCL2L10      catggagaagcagc---atcaggttcgcttccactccctagctca--gac
A0A3Q1GZ93_BCL2L1-      ctcggccaacgagtttgagttacgatacgctcgagcct----tcagcgat
A0A3Q1JZ46_BCL2L1-      ctctgctgacgagtttgaactgctcttcacacaagcgt----ttagtgac
A0A3Q1GX28_MCL1-01      cgttctggaaaaac----acagatacgcgtacaatggtatgatcaacaaa
A0A3Q1GX28_MCL1-02      cgttctggaaaaac----acagatacgcgtacaatggtatgatcaacaaa
                        *       *  *               *   *          * *   * 

A0A3Q1IAB0_BCL2L10      tttcctgaagcagtgcgggccggacc--------cctgctccagcctcag
A0A3Q1GZ93_BCL2L1-      ctgcacaaccagctgcatatcacgcctgccacagcctaccaaagcttcga
A0A3Q1JZ46_BCL2L1-      ctttcctcgcagcttgatgtcacgcccgacacggcctatcaaagctttaa
A0A3Q1GX28_MCL1-01      ctctc------actggatgaca------aagtggacgatgtgagttttat
A0A3Q1GX28_MCL1-02      ctctc------actggatgaca------aagtggacgatgtgagttttat
                         *           *      *              *      **  *   

A0A3Q1IAB0_BCL2L10      gaaggtgatggaggag---ctggtgggagatggacacatgaactggggga
A0A3Q1GZ93_BCL2L1-      gaacgtcatggatgaa---gtgttccgggacggtgtc---aactggggcc
A0A3Q1JZ46_BCL2L1-      gagtgtgatggacgag---ttgttcaaggatggagtc---aactggggac
A0A3Q1GX28_MCL1-01      cacggcagtagcccagagccttttctcagatggaaccacaaactggggtc
A0A3Q1GX28_MCL1-02      cacggcagtagcccagagccttttctcagatggaaccacaaactggggtc
                         *  *   * *   *     *  *    ** **   *   ********  

A0A3Q1IAB0_BCL2L10      gggttgtttcccttttcaccttcactggggtgctggccagacagatgctg
A0A3Q1GZ93_BCL2L1-      gcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtg
A0A3Q1JZ46_BCL2L1-      gtatagtggggctgtttgccttcggtggcgtgctgtgtgtggaatgtgtg
A0A3Q1GX28_MCL1-01      gtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaag
A0A3Q1GX28_MCL1-02      gtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaag
                        *  * *     **  *  * **    *  *   **       *      *

A0A3Q1IAB0_BCL2L10      gagcagaaggacaagaagccggggctggaccttgggaaggggcaggaact
A0A3Q1GZ93_BCL2L1-      gagaaggagatgagtcagctg-g---------tgggaagga---------
A0A3Q1JZ46_BCL2L1-      gagaagaatatgagtgagctg-g---------tatcccgaa---------
A0A3Q1GX28_MCL1-01      gaaaaacaca-gggagaactgtg---------tggatctgg---------
A0A3Q1GX28_MCL1-02      gaaaaacaca-gggagaactgtg---------tggatctgg---------
                        **  *  *        * * * *         *                 

A0A3Q1IAB0_BCL2L10      aggacaggagcctggacaatgtaggggactggcagagaccatagctgatt
A0A3Q1GZ93_BCL2L1-      -----------------------------tcgtagagtggatgacagtct
A0A3Q1JZ46_BCL2L1-      -----------------------------tcgcagactggatgaccatgt
A0A3Q1GX28_MCL1-01      -----------------------------tggcacaggagatctcctcat
A0A3Q1GX28_MCL1-02      -----------------------------tggcacaggagatctcctcat
                                                     * * * *    **  *    *

A0A3Q1IAB0_BCL2L10      acctgggagaagaga-------agaaagactggctgctggagaatgatgg
A0A3Q1GZ93_BCL2L1-      acctggacaaccacattcagccctggatccaa---agccaaggagg----
A0A3Q1JZ46_BCL2L1-      acctggatgagcacatcagtccttggatccag---agccagggagg----
A0A3Q1GX28_MCL1-01      acctg-------ctgtcagcccagcgagactggctggtcaggaacaactc
A0A3Q1GX28_MCL1-02      acctg-------ctgtcagcccagcgagactggctggtcaggaacaactc
                        *****                     *  *           * *      

A0A3Q1IAB0_BCL2L10      atgggaggggttctgtaagttctcc--------tgcagtgccagagaagt
A0A3Q1GZ93_BCL2L1-      atgggagcgctttgctgagctcttcggccacgacgcagcagcaga-----
A0A3Q1JZ46_BCL2L1-      atgggactgctttgctgagatatttgggcaagatgccgctgctga-----
A0A3Q1GX28_MCL1-01      atgggatggttttgttgaattcttt---cgagtggcagaccctgaatcca
A0A3Q1GX28_MCL1-02      atgggatggttttgttgaattcttt---cgagtggcagaccctgaatcca
                        ******  * **   * *  * *           ** *   * **     

A0A3Q1IAB0_BCL2L10      gagccaggactcctc--------catgaagagagcgctgtt---------
A0A3Q1GZ93_BCL2L1-      -gggcaggcggtctcaggagagtttca-agaagtggctgctggcagg---
A0A3Q1JZ46_BCL2L1-      -ggcgaggagatctcgggaggctctgagaaga-tggctgctagttgg---
A0A3Q1GX28_MCL1-01      cagtgaggaaatcactcatggcctttgcaggattggctggtattggggca
A0A3Q1GX28_MCL1-02      cagtgaggaaatcactcatggcctttgcaggattggctggtattggggca
                          *  ***    * *             *      **** *         

A0A3Q1IAB0_BCL2L10      ----tgctgctgctggtgtggg--tcttgcgggactcac-cttcctcctg
A0A3Q1GZ93_BCL2L1-      --catgaccctggtgactgggg--tcgtggtggggtcactcatagcgcag
A0A3Q1JZ46_BCL2L1-      --agtggtgctgctcacgggag--tgctgttaggtgtgctcattgctaag
A0A3Q1GX28_MCL1-01      tcactggccctgttgatcagctcctgtagtgtgatgtga-----------
A0A3Q1GX28_MCL1-02      tcactggccctgttgatcag----tgctgtccgacttcagcctc-ttcac
                            **   *** *     *    *   *   *                 

A0A3Q1IAB0_BCL2L10      gtgcg---ctag
A0A3Q1GZ93_BCL2L1-      aaacgcctgtga
A0A3Q1JZ46_BCL2L1-      aaacg---gtga
A0A3Q1GX28_MCL1-01      ------------
A0A3Q1GX28_MCL1-02      ctgca---ttaa
                                    

© 1998-2021Legal notice