Dataset for CDS BCL-2-like of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      atgcagactgctttgtcacggggagaaagggttcaacacggtactttaat
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ccgactgttgcacatctttgactctctgccaaaccagcgaacaactcctc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcg
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      tatctcggttatcgaacccctgaagctggcctgctagttagcagacgagc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      ----------------------atgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      taacgattgtcagatttcacccatgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      ---atg--------------------------------------------
A0A3Q1GX28_MCL1-01      ---atgttaccgtcgggcagaacagctatgaaactagccacgggaggaat
A0A3Q1GX28_MCL1-02      ---atgttaccgtcgggcagaacagctatgaaactagccacgggaggaat
A0A3Q1JZ46_BCL2L1-      ---atg--------------------------------------------
A0A7N6A4C8_BCL2-01      ---atggcgaacgagtg---------------------------------
A0A3Q1IAB0_BCL2L10      ---atg--------------------------------------------
A0A7N6A4C8_BCL2-02      ---atg----cttcttg---------------------------------
A0A7N6A4C8_BCL2-04      ---atg----cttcttg---------------------------------
A0A7N6A4C8_BCL2-07      attatg----cttcttg---------------------------------
A0A7N6A4C8_BCL2-05      ---atg----cttcttg---------------------------------
A0A7N6A4C8_BCL2-03      attatg----cttcttg---------------------------------
A0A7N6A4C8_BCL2-06      ---atg----cttcttg---------------------------------
                           ***                                            

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      gagctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggag
A0A3Q1GX28_MCL1-02      gagctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggag
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------taatcgcaa------------------------tattgtaga
A0A3Q1IAB0_BCL2L10      -----------ttccaactctcatggggactt-----tttcttctggagg
A0A7N6A4C8_BCL2-02      --------taattgctgccttcattgttgcctttgtgttgctgttataca
A0A7N6A4C8_BCL2-04      --------taattgctgccttcattgttgcctttgtgttgctgttataca
A0A7N6A4C8_BCL2-07      --------taattgctgccttcattgttgcctttgtgttgctgttataca
A0A7N6A4C8_BCL2-05      --------taattgctgccttcattgttgcctttgtgttgctgttataca
A0A7N6A4C8_BCL2-03      --------taattgctgccttcattgttgcctttgtgttgctgttataca
A0A7N6A4C8_BCL2-06      --------taattgctgccttcattgttgcctttgtgttgctgttataca
                                                                          

A0A3Q1GZ93_BCL2L1-      ---------------------------tctcaaaa------------cag
A0A3Q1GX28_MCL1-01      tcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacggg
A0A3Q1GX28_MCL1-02      tcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacggg
A0A3Q1JZ46_BCL2L1-      -gaag------------------aaatgtcgaaca--------gtaacag
A0A7N6A4C8_BCL2-01      aaagtatatctgccat-------aaactctccaaa--------c------
A0A3Q1IAB0_BCL2L10      cggagtcagcggata--------aatgtgcggacg--------ctgaggg
A0A7N6A4C8_BCL2-02      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
A0A7N6A4C8_BCL2-04      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
A0A7N6A4C8_BCL2-07      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
A0A7N6A4C8_BCL2-05      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
A0A7N6A4C8_BCL2-03      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
A0A7N6A4C8_BCL2-06      tgatatcacctcttattagtcccaaacctctgaaa--------ctgaacg
                                                        *                 

A0A3Q1GZ93_BCL2L1-      agaactggt--------------ggttttc--------------------
A0A3Q1GX28_MCL1-01      aatgctgctctgaaacgacccaagaacctggacgtgagctcatcgaatgg
A0A3Q1GX28_MCL1-02      aatgctgctctgaaacgacccaagaacctggacgtgagctcatcgaatgg
A0A3Q1JZ46_BCL2L1-      agagctggt-----------ggagttcttcat------------------
A0A7N6A4C8_BCL2-01      ggggctacg---------cgtgggggtttcat------------------
A0A3Q1IAB0_BCL2L10      gaaactgcg----agtgcaccgaggatctccttccgccgtcc------gt
A0A7N6A4C8_BCL2-02      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
A0A7N6A4C8_BCL2-04      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
A0A7N6A4C8_BCL2-07      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
A0A7N6A4C8_BCL2-05      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
A0A7N6A4C8_BCL2-03      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
A0A7N6A4C8_BCL2-06      gggcccacgtcgtggtgacgggaggctctagt---gggattg------gg
                            *                  *    *                     

A0A3Q1GZ93_BCL2L1-      ---tacataacatataa-----actatcccaga-------gaaacta---
A0A3Q1GX28_MCL1-01      ctatgcaacaaaaaacattggggctaacagcgacgacatcgaagacg---
A0A3Q1GX28_MCL1-02      ctatgcaacaaaaaacattggggctaacagcgacgacatcgaagacg---
A0A3Q1JZ46_BCL2L1-      -aatgtacaa------------actgtctcaaa-------gaaacca---
A0A7N6A4C8_BCL2-01      -gatgcccaagacgaagatgctgctaataatgg-------gtctgcagtt
A0A3Q1IAB0_BCL2L10      atgtgcagag-agcagactgatatcgctgggag-------gaaaatg---
A0A7N6A4C8_BCL2-02      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
A0A7N6A4C8_BCL2-04      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
A0A7N6A4C8_BCL2-07      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
A0A7N6A4C8_BCL2-05      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
A0A7N6A4C8_BCL2-03      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
A0A7N6A4C8_BCL2-06      aagtgcattgcaattgaatgctacagacaagga-------gcattca---
                           *                                    *         

A0A3Q1GZ93_BCL2L1-      ---------------tcctctcaaccacttgggactcaatgagactccca
A0A3Q1GX28_MCL1-01      ----------------gatctttgc-----cgtgcaccccggagctgatg
A0A3Q1GX28_MCL1-02      ----------------gatctttgc-----cgtgcaccccggagctgatg
A0A3Q1JZ46_BCL2L1-      --------cccagcctctcttctga-----gg--ccagatgataccggtg
A0A7N6A4C8_BCL2-01      ccccctccaccgactttggtccggc-----gg--tgccgtgaagccagca
A0A3Q1IAB0_BCL2L10      ---------------tcgtgtgggc-----tg--tggaaagacacc----
A0A7N6A4C8_BCL2-02      ---------------tcactttagt-----ggcacgaaatgaggctaa-a
A0A7N6A4C8_BCL2-04      ---------------tcactttagt-----ggcacgaaatgaggctaa-a
A0A7N6A4C8_BCL2-07      ---------------tcactttagt-----ggcacgaaatg---------
A0A7N6A4C8_BCL2-05      ---------------tcactttagt-----ggcacgaaatgaggctaa-a
A0A7N6A4C8_BCL2-03      ---------------tcactttagt-----ggcacgaaatgaggctaa-a
A0A7N6A4C8_BCL2-06      ---------------tcactttagt-----ggcacgaaatgaggctaa-a
                                                       *        *         

A0A3Q1GZ93_BCL2L1-      acaggactgatgggggggaagatgggttga-gtgaggaacagcggatagc
A0A3Q1GX28_MCL1-01      tcg-----gacagcgaggtcgatgtctccagttgtccagcaggggacgag
A0A3Q1GX28_MCL1-02      tcg-----gacagcgaggtcgatgtctccagttgtccagcaggggacgag
A0A3Q1JZ46_BCL2L1-      gagtgggagacaga-----------cccaa----ctcagcagctgctaac
A0A7N6A4C8_BCL2-01      ccgggcctgacagcg-acagcatcccgcaa----cactgcagacggctcc
A0A3Q1IAB0_BCL2L10      ctggctctggcagaggactacctgtccctg----tgctgca--------c
A0A7N6A4C8_BCL2-02      ttgcttcaggcaaagaaggaaatagagaaa----tttgcca--------t
A0A7N6A4C8_BCL2-04      ttgcttcaggcaaagaaggaaatagagaaa----tttgcca--------t
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ttgcttcaggcaaagaaggaaatagagaaa----tttgcca--------t
A0A7N6A4C8_BCL2-03      ttgcttcaggcaaagaaggaaatagagaaa----tttgcca--------t
A0A7N6A4C8_BCL2-06      ttgcttcaggcaaagaaggaaatagagaaa----tttgcca--------t
                                                                          

A0A3Q1GZ93_BCL2L1-      aac------gcacgccaacgggacttttaatggtagaagtcccgggaccc
A0A3Q1GX28_MCL1-01      gtgctggagaacgacacgaggcagctcctaagccagtttctccaagactt
A0A3Q1GX28_MCL1-02      gtgctggagaacgacacgaggcagctcctaagccagtttctccaagactt
A0A3Q1JZ46_BCL2L1-      ggcctgccggtcagcaggag-----tggcgagctggggaactcgtcacct
A0A7N6A4C8_BCL2-01      ctccgtccgacccgcacgctgcgctccacag---------------ggtc
A0A3Q1IAB0_BCL2L10      cagcccttggccagc------ccctccacctcccagcgagtcagccgctg
A0A7N6A4C8_BCL2-02      caa----tgacaaacaggtggtgctttgcatatcagtggat-----gttt
A0A7N6A4C8_BCL2-04      caa----tgacaaacaggtggtgctttgcatatcagtggat-----gttt
A0A7N6A4C8_BCL2-07      ---------------aggtggtgctttgcatatcagtggat-----gttt
A0A7N6A4C8_BCL2-05      caa----tgacaaacaggtggtgctttgcatatcagtggat-----gttt
A0A7N6A4C8_BCL2-03      caa----tgacaaacaggtggtgctttgcatatcagtggat-----gttt
A0A7N6A4C8_BCL2-06      caa----tgacaaacaggtggtgctttgcatatcagtggat-----gttt
                                                                          

A0A3Q1GZ93_BCL2L1-      ccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
A0A3Q1GX28_MCL1-01      tt--------------ctggacttactaagcctcgttggtgtgaaaccaa
A0A3Q1GX28_MCL1-02      tt--------------ctggacttactaagcctcgttggtgtgaaaccaa
A0A3Q1JZ46_BCL2L1-      cc--------------gtgtaa--------------gagcatggaggccg
A0A7N6A4C8_BCL2-01      ct--------------gcgtga-----g------gctggagatgaacttg
A0A3Q1IAB0_BCL2L10      cc--------------atgagac----g------tctggcccaggacatg
A0A7N6A4C8_BCL2-02      cc--------------a-gtgattatag------tcaggtggaaagtgtg
A0A7N6A4C8_BCL2-04      cc--------------a-gtgattatag------tcaggtggaaagtgtg
A0A7N6A4C8_BCL2-07      cc--------------a-gtgattatag------tcaggtggaaagtgtg
A0A7N6A4C8_BCL2-05      cc--------------a-gtgattatag------tcaggtggaaagtgtg
A0A7N6A4C8_BCL2-03      cc--------------a-gtgattatag------tcaggtggaaagtgtg
A0A7N6A4C8_BCL2-06      cc--------------a-gtgattatag------tcaggtggaaagtgtg
                                          *                               

A0A3Q1GZ93_BCL2L1-      gatg-------cggtgaaagaggccctccgggactcggccaacgagtttg
A0A3Q1GX28_MCL1-01      agaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacaca
A0A3Q1GX28_MCL1-02      agaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacaca
A0A3Q1JZ46_BCL2L1-      taaa------------aacagctcttaggga--ctctgctgacgagtttg
A0A7N6A4C8_BCL2-01      a-aa------------gactatatcagccggacttc---------acgga
A0A3Q1IAB0_BCL2L10      gaga------------agcagcatcaggttcgcttccactccctagctca
A0A7N6A4C8_BCL2-02      ataa------------aacaggctcaagaga-------------agctgg
A0A7N6A4C8_BCL2-04      ataa------------aaca------------------------------
A0A7N6A4C8_BCL2-07      ataa------------aacaggctcaagaga-------------agctgg
A0A7N6A4C8_BCL2-05      ataa------------aacaggctcaagaga-------------agctgg
A0A7N6A4C8_BCL2-03      ataa------------aacaggctcaagaga-------------agctgg
A0A7N6A4C8_BCL2-06      ataa------------aacaggctcaagaga-------------agctgg
                                                                          

A0A3Q1GZ93_BCL2L1-      agttacgatacgctcgagccttcagcgatctgcacaaccagctgcatatc
A0A3Q1GX28_MCL1-01      gatacgcgtacaatggtatgatcaacaaactct-----------cactgg
A0A3Q1GX28_MCL1-02      gatacgcgtacaatggtatgatcaacaaactct-----------cactgg
A0A3Q1JZ46_BCL2L1-      aactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtc
A0A7N6A4C8_BCL2-01      gatgtcccgacagc----tg------------------------tatctc
A0A3Q1IAB0_BCL2L10      gactttcctgaagcagtgcg------------------------ggccgg
A0A7N6A4C8_BCL2-02      gacctgttgatatgcttgtg------------------------aactgt
A0A7N6A4C8_BCL2-04      -------------------g------------------------cacttt
A0A7N6A4C8_BCL2-07      gacctgttgatatgcttgtg------------------------aactgt
A0A7N6A4C8_BCL2-05      gacctgttgatatgcttgtg------------------------aactgt
A0A7N6A4C8_BCL2-03      gacctgttgatatgcttgtg------------------------aactgt
A0A7N6A4C8_BCL2-06      gacctgttgatatgcttgtg------------------------aactgt
                                                                          

A0A3Q1GZ93_BCL2L1-      acgcctgccacagcctaccaaagct--tcgagaacgtcatggatga---a
A0A3Q1GX28_MCL1-01      atgacaaagtggacgatgtgagttttatcacggcagtagcccagagcctt
A0A3Q1GX28_MCL1-02      atgacaaagtggacgatgtgagttttatcacggcagtagcccagagcctt
A0A3Q1JZ46_BCL2L1-      acgcccgacacggcctatcaaagct--ttaagagtgtgatggacga---g
A0A7N6A4C8_BCL2-01      acctccaccacggcgcagcggagat--tcgccgaggtgatagacga---a
A0A3Q1IAB0_BCL2L10      acccctgctccagcctcaggaaggtgatggaggagctggtgggag----a
A0A7N6A4C8_BCL2-02      gctggaacatcaatgtctggaaagt--ttgaggaggtggaggtgg----a
A0A7N6A4C8_BCL2-04      actccagattccactattgcaaaat---------------gttggcctta
A0A7N6A4C8_BCL2-07      gctggaacatcaatgtctggaaagt--ttgaggaggtggaggtgg----a
A0A7N6A4C8_BCL2-05      gctggaacatcaatgtctggaaagt--ttgaggaggtggaggtgg----a
A0A7N6A4C8_BCL2-03      gctggaacatcaatgtctggaaagt--ttgaggaggtggaggtgg----a
A0A7N6A4C8_BCL2-06      gctggaacatcaatgtctggaaagt--ttgaggaggtggaggtgg----a
                                                *                         

A0A3Q1GZ93_BCL2L1-      gtgttccg-------ggacggtgtcaactggggccgcattgtagggc---
A0A3Q1GX28_MCL1-01      ttctcaga-------tggaaccacaaactggggtcgtatcgccagcc---
A0A3Q1GX28_MCL1-02      ttctcaga-------tggaaccacaaactggggtcgtatcgccagcc---
A0A3Q1JZ46_BCL2L1-      ttgttcaa-------ggatggagtcaactggggacgtatagtggggc---
A0A7N6A4C8_BCL2-01      ctgttccg-------ggacggggtgaactggggccgga------------
A0A3Q1IAB0_BCL2L10      tggacaca---------------tgaactgggggagggttgtttccc---
A0A7N6A4C8_BCL2-02      ttgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaa
A0A7N6A4C8_BCL2-04      ttttcaccagaaactgatggaagtgaactacctgggcagcgtttacccaa
A0A7N6A4C8_BCL2-07      ttgttttaaa----------------------------------------
A0A7N6A4C8_BCL2-05      ttgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaa
A0A7N6A4C8_BCL2-03      ttgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaa
A0A7N6A4C8_BCL2-06      ttgttttaaa----------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      ---------tttttgcgt------------------tcggtggggcgctg
A0A3Q1GX28_MCL1-01      ---------tggtggccttt----------------ggggcagca-----
A0A3Q1GX28_MCL1-02      ---------tggtggccttt----------------ggggcagca-----
A0A3Q1JZ46_BCL2L1-      ---------tgtttgcct------------------tcggtggcgtgctg
A0A7N6A4C8_BCL2-01      ---------ttatcgctttcttcgagt---------tcggcggcaccgtg
A0A3Q1IAB0_BCL2L10      ---------ttttcaccttcactggggtgc------tggccagacagatg
A0A7N6A4C8_BCL2-02      cacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatg
A0A7N6A4C8_BCL2-04      cacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatg
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      cacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatg
A0A7N6A4C8_BCL2-03      cacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatg
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      tgcgtcgagtgtgtgg---agaaggagatgagtcagctggtgggaa----
A0A3Q1GX28_MCL1-01      ------gtgtgtcagcacctgaagga------------------------
A0A3Q1GX28_MCL1-02      ------gtgtgtcagcacctgaagga------------------------
A0A3Q1JZ46_BCL2L1-      tgtgtggaatgtgtgg---agaagaatatgagtgagctggtatccc----
A0A7N6A4C8_BCL2-01      tgcgtggagtgcgcgtccaaggaggagatgacaccgcaggtgaaca----
A0A3Q1IAB0_BCL2L10      c-----tggagc-------agaaggacaagaagccggggctggacc----
A0A7N6A4C8_BCL2-02      t-----ttgtgtcctcccaagcaggacaggttggcctgtttggatacact
A0A7N6A4C8_BCL2-04      t-----ttgtgtcctcccaagcaggacaggttggcctgtttggatacact
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      t-----ttgtgtcctcccaagcaggacaggttggcctgtttggatacact
A0A7N6A4C8_BCL2-03      t-----ttgtgtcctcccaagcaggacaggttggcctgtttggatacact
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      ------------------------------------------------gg
A0A3Q1GX28_MCL1-01      ------------------------------------------------aa
A0A3Q1GX28_MCL1-02      ------------------------------------------------aa
A0A3Q1JZ46_BCL2L1-      ------------------------------------------------ga
A0A7N6A4C8_BCL2-01      ------------------------------------------------ac
A0A3Q1IAB0_BCL2L10      --------------------------------ttgggaaggggca---gg
A0A7N6A4C8_BCL2-02      gcctactccccatccaagtttgccctgcgtggtttagcagagtcactgca
A0A7N6A4C8_BCL2-04      gcctactccccatccaagtttgccctgcgtggtttagcagagtcactgca
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      gcctactccccatccaagtttgccctgcgtggtttagcagagtcactgca
A0A7N6A4C8_BCL2-03      gcctactccccatccaagtttgccctgcgtggtttagcagagtcactgca
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q1GZ93_BCL2L1-      atcgtagagtgga----------------------tgacagtctacctgg
A0A3Q1GX28_MCL1-01      aacacagggagaactgtgtggatctggtggcacaggagatctcctcatac
A0A3Q1GX28_MCL1-02      aacacagggagaactgtgtggatctggtggcacaggagatctcctcatac
A0A3Q1JZ46_BCL2L1-      atcgcagactgga----------------------tgaccatgtacctgg
A0A7N6A4C8_BCL2-01      atcgcagagtggatgacggagtatttaaa------tggacctcttcacag
A0A3Q1IAB0_BCL2L10      aactaggacaggagcctggacaatgtaggggac--tggcagagaccatag
A0A7N6A4C8_BCL2-02      gatggagataaagccctacaatatatatgtgacagtggcctacccccccg
A0A7N6A4C8_BCL2-04      gatggagataaagccctacaatatatatgtgacagtggcctacccccccg
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      gatggagataaagccctacaatatatatgtgacagtggcctacccccccg
A0A7N6A4C8_BCL2-03      gatggagataaagccctacaatatatatgtgacagtggcctacccccccg
A0A7N6A4C8_BCL2-06      -------ataaagccctacaatatatatgtgacagtggcctacccccccg
                                                                          

A0A3Q1GZ93_BCL2L1-      acaaccacattcagccctggatccaaagccaaggaggatgg---------
A0A3Q1GX28_MCL1-01      ctgctgtc-----------------agcccagcgagactggctggtcagg
A0A3Q1GX28_MCL1-02      ctgctgtc-----------------agcccagcgagactggctggtcagg
A0A3Q1JZ46_BCL2L1-      atgagcacatcagtccttggatccagagccagggaggatgg---------
A0A7N6A4C8_BCL2-01      ctggatac----------------aagataacgggggatgg---------
A0A3Q1IAB0_BCL2L10      ctgattac---------ctgggagaagagaagaaagactggctgctggag
A0A7N6A4C8_BCL2-02      acactgacactccaggtttggctgaggaaaataagacaaagcctctggag
A0A7N6A4C8_BCL2-04      acactgacactccaggtttggctgaggaaaataagacaaagcctctggag
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      acactgacactccaggtttggctgaggaaaataagacaaagcctctggag
A0A7N6A4C8_BCL2-03      acactgacactccaggtttggctgaggaaaataagacaaagcctctggag
A0A7N6A4C8_BCL2-06      acactgacactccaggtttggctgaggaaaataagacaaagcctctggag
                                                                          

A0A3Q1GZ93_BCL2L1-      ---------------------------------------gagcgctttgc
A0A3Q1GX28_MCL1-01      aacaactca-----------------------------------------
A0A3Q1GX28_MCL1-02      aacaactca-----------------------------------------
A0A3Q1JZ46_BCL2L1-      ---------------------------------------gactgctttgc
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      aat-----------------------------------------------
A0A7N6A4C8_BCL2-02      accaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
A0A7N6A4C8_BCL2-04      accaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      accaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
A0A7N6A4C8_BCL2-03      accaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
A0A7N6A4C8_BCL2-06      accaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
                                                                          

A0A3Q1GZ93_BCL2L1-      tgagctcttcggccacgacgc-----------------------------
A0A3Q1GX28_MCL1-01      -------------tgggatgg-----------------------------
A0A3Q1GX28_MCL1-02      -------------tgggatgg-----------------------------
A0A3Q1JZ46_BCL2L1-      tgagatatttgggcaagatgc-----------------------------
A0A7N6A4C8_BCL2-01      ----------------gatgc-----------------------------
A0A3Q1IAB0_BCL2L10      ----------------gatggatgggaggggttctgtaa-----------
A0A7N6A4C8_BCL2-02      caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgg
A0A7N6A4C8_BCL2-04      caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgg
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      caaaatcattgtgcgagatgca----------------------------
A0A7N6A4C8_BCL2-03      caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgg
A0A7N6A4C8_BCL2-06      caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgg
                                                                          

A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A7N6A4C8_BCL2-02      gacctgatggttacatgctctctgccctcacctgtggaatgtcacccgtt
A0A7N6A4C8_BCL2-04      gacctgatggttacatgctctctgccctcacctgtggaatgtcacccgtt
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      gacctgatggttacatgctctctgccctcacctgtggaatgtcacccgtt
A0A7N6A4C8_BCL2-06      gacctgatggttacatgctctctgccctcacctgtggaatgtcacccgtt
                                                                          

A0A3Q1GZ93_BCL2L1-      -------------agcagcagagggcaggcggtctcaggagagtttcaag
A0A3Q1GX28_MCL1-01      --------------------------------ttttgttgaattcttt--
A0A3Q1GX28_MCL1-02      --------------------------------ttttgttgaattcttt--
A0A3Q1JZ46_BCL2L1-      -------------cgctgctgaggcgaggagatctcgggaggctctgaga
A0A7N6A4C8_BCL2-01      --------------------------------cttcgtggacctgtatga
A0A3Q1IAB0_BCL2L10      ---------------gttctcctgcag-----tgccagagaag-------
A0A7N6A4C8_BCL2-02      acctccattacagagggtctccagcaggatgccttcgtggacctgtatga
A0A7N6A4C8_BCL2-04      acctccattacagagggtctccagcagataattaccatgggattattt--
A0A7N6A4C8_BCL2-07      ---------------------------ataattaccatgggattattt--
A0A7N6A4C8_BCL2-05      ---------------------------ataattaccatgggattattt--
A0A7N6A4C8_BCL2-03      acctccattacagagggtctccagcagataattaccatgggattattt--
A0A7N6A4C8_BCL2-06      acctccattacagagggtctccagcagataattaccatgggattattt--
                                                                          

A0A3Q1GZ93_BCL2L1-      aagtggctgctggcaggcatgaccctggtgact-ggggtcgt-------g
A0A3Q1GX28_MCL1-01      ---------cgagtggcagaccc-----------tgaatccacagtgagg
A0A3Q1GX28_MCL1-02      ---------cgagtggcagaccc-----------tgaatccacagtgagg
A0A3Q1JZ46_BCL2L1-      agatggctgctagttggagtggtgctgctcacg-ggagtgct-------g
A0A7N6A4C8_BCL2-01      cagacagagggagtctgtgttcagttgctcctg----gtcctccatcaag
A0A3Q1IAB0_BCL2L10      ---------tgagcca------------------ggactcctccatgaag
A0A7N6A4C8_BCL2-02      cagacagagggagtctgtgttcagttgctcctg----gtcctccatcaag
A0A7N6A4C8_BCL2-04      ---------cgaaccattgccctgttctacttggggagtttt-------g
A0A7N6A4C8_BCL2-07      ---------cgaaccattgccctgttctacttggggagtttt-------g
A0A7N6A4C8_BCL2-05      ---------cgaaccattgccctgttctacttggggagtttt-------g
A0A7N6A4C8_BCL2-03      ---------cgaaccattgccctgttctacttggggagtttt-------g
A0A7N6A4C8_BCL2-06      ---------cgaaccattgccctgttctacttggggagtttt-------g
                                                              *          *

A0A3Q1GZ93_BCL2L1-      gtggggtcactcatagc-------------------gcagaaacgcctgt
A0A3Q1GX28_MCL1-01      aaatcactcatggcctttgcaggattggctggtattggggcatcactggc
A0A3Q1GX28_MCL1-02      aaatcactcatggcctttgcaggattggctggtattggggcatcactggc
A0A3Q1JZ46_BCL2L1-      ttaggtgtgctcattgctaa------------------------------
A0A7N6A4C8_BCL2-01      acggtcttcggcctcgctgc---tct--cggggcagccagcctcaccatt
A0A3Q1IAB0_BCL2L10      agagcgctgtttgctgctgc-tggtg--tgggtcttgcgggactcacctt
A0A7N6A4C8_BCL2-02      acggtcttcggcctcgctgc---tct--cggggcagccagcctcaccatt
A0A7N6A4C8_BCL2-04      acagcatcgtacgccgctgcatgatt--caaagagagcagtcaaaa----
A0A7N6A4C8_BCL2-07      acagcatcgtacgccgctgcatgatt--caaagagagcagtcaaaa----
A0A7N6A4C8_BCL2-05      acagcatcgtacgccgctgcatgatt--caaagagagcagtcaaaa----
A0A7N6A4C8_BCL2-03      acagcatcgtacgccgctgcatgatt--caaagagagcagtcaaaa----
A0A7N6A4C8_BCL2-06      acagcatcgtacgccgctgcatgatt--caaagagagcagtcaaaa----
                                                                          

A0A3Q1GZ93_BCL2L1-      ga------------------------------------------------
A0A3Q1GX28_MCL1-01      cctgttgatcagctcctgtagtgtgatgtga-------------------
A0A3Q1GX28_MCL1-02      cctgttgatcag----tgctgtccgacttcagcctcttcacctgcattaa
A0A3Q1JZ46_BCL2L1-      -----------gaaacggtga-----------------------------
A0A7N6A4C8_BCL2-01      ggagcttaccttgcacagaaatga--------------------------
A0A3Q1IAB0_BCL2L10      cctcctggtgcgctag----------------------------------
A0A7N6A4C8_BCL2-02      ggagcttaccttgcacagaaatga--------------------------
A0A7N6A4C8_BCL2-04      gcagctgacaagagagagtaa-----------------------------
A0A7N6A4C8_BCL2-07      gcagctgacaagagagagtaa-----------------------------
A0A7N6A4C8_BCL2-05      gcagctgacaagagagagtaa-----------------------------
A0A7N6A4C8_BCL2-03      gcagctgacaagagagagtaa-----------------------------
A0A7N6A4C8_BCL2-06      gcagctgacaagagagagtaa-----------------------------
                                                                          

© 1998-2022Legal notice