Dataset for CDS BCL2A1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B4E1X9_BCL2A1-01      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
Q16548_BCL2A1-01      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
                      **************************************************

B4E1X9_BCL2A1-01      gcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgt
Q16548_BCL2A1-01      gcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgt
                      **************************************************

B4E1X9_BCL2A1-01      ccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaag
Q16548_BCL2A1-01      ccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaag
                      **************************************************

B4E1X9_BCL2A1-01      aatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgc
Q16548_BCL2A1-01      aatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgc
                      **************************************************

B4E1X9_BCL2A1-01      cagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatca
Q16548_BCL2A1-01      cagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatca
                      **************************************************

B4E1X9_BCL2A1-01      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
Q16548_BCL2A1-01      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                      **************************************************

B4E1X9_BCL2A1-01      aagaaacttctacgacagcaaattgccccggatgtggatacctataagga
Q16548_BCL2A1-01      aagaaacttctacgacagcaaattgccccggatgtggatacctataagga
                      **************************************************

B4E1X9_BCL2A1-01      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
Q16548_BCL2A1-01      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
                      **************************************************

B4E1X9_BCL2A1-01      taaggcaaaacggaggctgggtatgtg---tgatggaaaaatt-------
Q16548_BCL2A1-01      taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacct
                      ********************* *  **   *  *  * ** **       

B4E1X9_BCL2A1-01      --------cttcattgttctttcctgtgaaatagaaa----ttgagaa--
Q16548_BCL2A1-01      aaatctggctggatgacttttctagaagttacaggaaagatctgtgaaat
                              **  **   * **      *  * ** **     ** ***  

B4E1X9_BCL2A1-01      ------tttcct-------tgctagttaa
Q16548_BCL2A1-01      gctatctctcctgaagcaatact-gttga
                            * ****       * ** *** *

© 1998-2020Legal notice