Dataset for CDS BCL2A1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q16548_BCL2A1-03      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
Q16548_BCL2A1-01      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
Q16548_BCL2A1-02      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
                      **************************************************

Q16548_BCL2A1-03      gcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgt
Q16548_BCL2A1-01      gcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgt
Q16548_BCL2A1-02      gcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgt
                      **************************************************

Q16548_BCL2A1-03      ccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaag
Q16548_BCL2A1-01      ccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaag
Q16548_BCL2A1-02      ccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaag
                      **************************************************

Q16548_BCL2A1-03      aatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgc
Q16548_BCL2A1-01      aatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgc
Q16548_BCL2A1-02      aatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgc
                      **************************************************

Q16548_BCL2A1-03      cagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatca
Q16548_BCL2A1-01      cagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatca
Q16548_BCL2A1-02      cagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatca
                      **************************************************

Q16548_BCL2A1-03      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
Q16548_BCL2A1-01      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
Q16548_BCL2A1-02      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                      **************************************************

Q16548_BCL2A1-03      aagaaacttctacgacagcaaattgccccggatgtggatacctataagga
Q16548_BCL2A1-01      aagaaacttctacgacagcaaattgccccggatgtggatacctataagga
Q16548_BCL2A1-02      aagaaacttctacgacagcaaattgccccggatgtggatacctataagga
                      **************************************************

Q16548_BCL2A1-03      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
Q16548_BCL2A1-01      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
Q16548_BCL2A1-02      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
                      **************************************************

Q16548_BCL2A1-03      taaggcaaaacggaggct-gggtatgtgtgatggaaaaattcttcattgt
Q16548_BCL2A1-01      taaggcaaaacggaggctgggggaaatggc-------acaatcacacacc
Q16548_BCL2A1-02      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
                      ****************** *** *  **         *            

Q16548_BCL2A1-03      tctttcctgtgaaat------------agaaattgagaatttccttgcta
Q16548_BCL2A1-01      tatg-ctggtagagtcagtggcccacaagaagaggaaaatggctttgtaa
Q16548_BCL2A1-02      taaatctggctggatgacttttctagaagttacaggaaagatctgtgaaa
                      *    *  *     *            **     *  **   *  **  *

Q16548_BCL2A1-03      ------------------------gttaa
Q16548_BCL2A1-01      -----------------------------
Q16548_BCL2A1-02      tgctatctctcctgaagcaatactgttga
                                                   

© 1998-2022Legal notice