Dataset for CDS BOK of Organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1F1K1_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
A0A3Q1FIY9_BOK-01      atggaggtgctgcgtaggtcctctgtgtttgctgcagaggtcctggatgt
                       ****** ** ****  * ************** ** **          **

A0A3Q1F1K1_BOK-01      gtttgaccgatcacccaccgacaaggagctggtgtcccaggccaaagctc
A0A3Q1FIY9_BOK-01      gtttgaccgatcgctgactgagaaggagctggtgtcccagtccaaagctc
                       ************ *  ** ** ****************** *********

A0A3Q1F1K1_BOK-01      tgtgcagagactacatccactccaggctgaaccgggcagggatcggctgg
A0A3Q1FIY9_BOK-01      tgtgcagagactacatcctgtccagactcaaccagaacgggctgggatgg
                       ******************  ***** ** **** *   *** * ** ***

A0A3Q1F1K1_BOK-01      tctaaacccgagcacggactggctgcgtcaggtgggactctgggagaggt
A0A3Q1FIY9_BOK-01      tctaaaactgagatcaactttggtccgtccaatgcagcgctggccgaggt
                       ****** * ***  *    * * * ****   **   * ****  *****

A0A3Q1F1K1_BOK-01      ctcctctgtcctgctgtggctgggtgatgagttggaatatcttcgtccca
A0A3Q1FIY9_BOK-01      gtctctggtgcttctctgtcttggcgacgagctggagtgtatacagccca
                        **    ** ** ** ** ** ** ** *** **** * * * *  ****

A0A3Q1F1K1_BOK-01      acgtttatcggaacgtcgcccgacagctgaacatcacagtagcttcagag
A0A3Q1FIY9_BOK-01      gtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
                          * **  ******* ** ** ***** *****  * ** **    ***

A0A3Q1F1K1_BOK-01      agcattgtgtctgatgccttcctggctgttgctgcagacattttctccac
A0A3Q1FIY9_BOK-01      aacatggtttcggatgccttcatcggtgtggcaacggagatcttctctgc
                       * *** ** ** ********* * * *** **  * ** ** *****  *

A0A3Q1F1K1_BOK-01      aggtgtgacatgggggaaggtggtttccttgtatgctgtggcaggagctc
A0A3Q1FIY9_BOK-01      aggtataacatggggtaaagtggtatccatgtacgcagtagctggagccc
                       **** * ******** ** ***** *** **** ** ** ** ***** *

A0A3Q1F1K1_BOK-01      tggcggtggactgcgttcgccacggtcatcctgctatggtccacaccatt
A0A3Q1FIY9_BOK-01      tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatctta
                       **** ** ***** **  * ** ** *****  * *  ** **** * * 

A0A3Q1F1K1_BOK-01      gtggactgcatgggggagtttgtccgcaagagtctgacctcctggttaaa
A0A3Q1FIY9_BOK-01      gtggacagtctgggacagtttgttcgcaaattcctggtgccctggctgaa
                       ****** *  ****  ******* *****    ***    ***** * **

A0A3Q1F1K1_BOK-01      gaagagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatc
A0A3Q1FIY9_BOK-01      aagacgagggggatgggtgagtattacaaaatgtgtggtgaagaaggatc
                        *   **** ** ****    *** ** ************** *  ****

A0A3Q1F1K1_BOK-01      ccagtttccgttctcactggctggtgtctgctgtctgtgcctttggacac
A0A3Q1FIY9_BOK-01      tcgctcccgaacaaaactggttctcctctactgtggagtctctcaagtac
                        *  *  *       ***** *    *** ****     *  *     **

A0A3Q1F1K1_BOK-01      tacctgaaggccgtcgtgt---tgtacctcctcagggagaagtga
A0A3Q1FIY9_BOK-01      ttcctga---ccacaatgtacgtctacatcatgaaggagccgtga
                       * *****   **    ***   * *** ** * * ****  ****

© 1998-2020Legal notice