Dataset for CDS BAX-like of Organism Athene cunicularia

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A663LT62_BOK-01       atg-----gaagtactacgccgttcctc----agtcttt----gctgcag
A0A663MKT2_BAK1-01      atggcctcggggaacaacagtgacccaccaagggcccatggacgccaggg
                        ***     *  * ** **   *  ** *     * *  *    **    *

A0A663LT62_BOK-01       aggtgatgg----aggtttttgacaggtctcccact--------------
A0A663MKT2_BAK1-01      aagcaacgggcgcaggctgtc-acaagagctcaactcagaagaccaggtg
                        * *  * **    *** * *  *** *    * ***              

A0A663LT62_BOK-01       ------gacaaggagcttgtgtcccaagccaaggctctctgcagagacta
A0A663MKT2_BAK1-01      gcagaggagacggaggaggtgtttcggagttatgccttctaccgctacca
                              ** * ****   ****  *      * **  *** * *  ** *

A0A663LT62_BOK-01       ---------------------------------cataaattcgaggctaa
A0A663MKT2_BAK1-01      acaggagagagaggagagaggggaggaaatgcccatggacccagaga---
                                                         ***  *  *   *    

A0A663LT62_BOK-01       ttcgagcaggtgtcagctggagcaaacctgagcacaacacaccagtgcct
A0A663MKT2_BAK1-01      -tcgcggagat-ccagcaggag-----ctgggcagcac---cgggagcct
                         *** * ** *  **** ****     *** ***  **   *  * ****

A0A663LT62_BOK-01       ggcggtaaactggctgaggtgtccaccatactgctgcgactgggggatga
A0A663MKT2_BAK1-01      ggtgggaaggcgcttgg-----ccatcat-cggcgacgac--attaacga
                        ** ** **   *  **      *** *** * **  ****      * **

A0A663LT62_BOK-01       gctggaatacattcgccccaacgtctaccggaacattgcccgccaattga
A0A663MKT2_BAK1-01      gcggta------------cgacg-----cggagtttcg-ctacatgctga
                        ** * *            * ***     ****   * * *  *    ***

A0A663LT62_BOK-01       acatctcgctgcac-tcagagacggtggtgacggatgccttcctggcagt
A0A663MKT2_BAK1-01      agtccttgcagcccaccaaggagaacgcctatgagtacttcaccag-aat
                        *   ** ** ** *  **  **    *   * *  * * *  *  * * *

A0A663LT62_BOK-01       agctgcacagatt-ttcactgcaggcataacatggggcaaggtggtgtct
A0A663MKT2_BAK1-01      agcctc-cagcttgttcgagagtggcattaactggggccgggtgat----
                        ***  * *** ** ***      ***** *  ******  **** *    

A0A663LT62_BOK-01       ctctatgcagtggcagcggggctggcagtggactgtgtgcggcacgcgca
A0A663MKT2_BAK1-01      -----tgca----ctgctgggct-----ttggctac--------cgcatg
                             ****    * ** *****     * * **          ***   

A0A663LT62_BOK-01       gccagccatggttcacaccatcgtagactgcctgggagagtttgtccgca
A0A663MKT2_BAK1-01      gccatccacgtctaccagcacggcataccg-------ggtttcctccgcc
                        **** *** *  *  ** **  * * ** *       *  **  ***** 

A0A663LT62_BOK-01       agac--cttggtggcatggctgaaaaggagaggaggct--gggcagacat
A0A663MKT2_BAK1-01      ggatcgcccggt-acgtggc------ggaattcatgctccggaaccgcat
                         **   *  ***  * ****      ***    * ***  **     ***

A0A663LT62_BOK-01       cacaaaatgcgtggtgaatactgaccccagca---------------ttc
A0A663MKT2_BAK1-01      cgcccagtggatcg-----------cccagcagggaggatgggtggctgc
                        * *  * **  * *           *******               * *

A0A663LT62_BOK-01       gctcccactggctcgtg----------------gccgctgtttgcagctt
A0A663MKT2_BAK1-01      actcgagctggacaatgtttacatgaagtacatgctggtggtggtggccc
                         ***   ****    **                ** * ** * *  **  

A0A663LT62_BOK-01       tggtcac------ttcctcaaggctat----cttcttcgtcctgctgcct
A0A663MKT2_BAK1-01      tggtcatggtggggcatttagtggtacgacgcttcttcaggc-----cct
                        ******           * *  * **     *******   *     ***

A0A663LT62_BOK-01       gagagatga
A0A663MKT2_BAK1-01      aa-------
                         *       

© 1998-2023Legal notice