Dataset for CDS BCL-2-like of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6LV19_BCL2A1-      atgacagactg-----tgaatttggatatatttacaggctagctcagg--
A0A2K6LV19_BCL2A1-      atgacagactg-----tgaatttggatatatttacaggctagctcagg--
A0A2K6M5H5_BCL2L10      atggctgacccgttgcgggagcgcaccaccgtggctgacccgttgc-gcg
A0A2K6KRW9_MCL1-02      atgtttggctt-caaaagaaacgcggtaatcggactcaacctctactgtg
A0A2K6KRW9_MCL1-01      atgtttggctt-caaaagaaacgcggtaatcggactcaacctctactgtg
A0A2K6KRW9_MCL1-03      atgtttggctt-caaaagaaacgcggtaatcggactcaacctctactgtg
A0A2K6KHG1_BCL2-01      atggcgcacgc----tgggagaacagggtac-gataaccgggagatagtg
A0A2K6ME72_BCL2L2-      atggcgacccc--------agcctcggccccagacacacgggctctggtg
A0A2K6ME72_BCL2L2-      atggcgacccc--------agcctcggccccagacacacgggctctggtg
                        ***     *          *                           *  

A0A2K6LV19_BCL2A1-      ---------actatttgcagtacgtcctgcaga-----taccacaacctg
A0A2K6LV19_BCL2A1-      ---------actatttgcagtacgtcctgcaga-----taccacaacctg
A0A2K6M5H5_BCL2L10      agcgcaccgagcggttgctggccgactatctggggtgctgcgc--ccggg
A0A2K6KRW9_MCL1-02      ggggggccg---gcttgggggccggc-agcggcggcgccacccctccggg
A0A2K6KRW9_MCL1-01      ggggggccg---gcttgggggccggc-agcggcggcgccacccctccggg
A0A2K6KRW9_MCL1-03      ggggggccg---gcttgggggccggc-agcggcggcgccacccctccggg
A0A2K6KHG1_BCL2-01      atgaagtacatccactataagctgtc--gcagaggggctacga--gtggg
A0A2K6ME72_BCL2L2-      gcagactttgtaggttataagctgag--gcagaagggttatgt--ctgtg
A0A2K6ME72_BCL2L2-      gcagactttgtaggttataagctgag--gcagaagggttatgt--ctgtg
                                       *       *     * *                 *

A0A2K6LV19_BCL2A1-      gatcggg-------------------------------------------
A0A2K6LV19_BCL2A1-      gatcggg-------------------------------------------
A0A2K6M5H5_BCL2L10      aacccgg------------------c------------------------
A0A2K6KRW9_MCL1-02      agggcgg------------------cttttggctacggagaaggaggcct
A0A2K6KRW9_MCL1-01      agggcgg------------------cttttggctacggagaaggaggcct
A0A2K6KRW9_MCL1-03      agggcgg------------------ctttt--------------------
A0A2K6KHG1_BCL2-01      atgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggc
A0A2K6ME72_BCL2L2-      gagctgg------------------ccctgggg-----------------
A0A2K6ME72_BCL2L2-      gagctgg------------------ccctgggg-----------------
                             **                                           

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cggcccggcgagagatagggggaggggaggccggcacggtgattggcgaa
A0A2K6KRW9_MCL1-01      cggcccggcgagagatagggggaggggaggccggcacggtgattggcgaa
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      atcttctcctcccagcccgggcacacgccccatcccgccgcgtcccggga
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------tccaag
A0A2K6LV19_BCL2A1-      --------------------------------------------tccaag
A0A2K6M5H5_BCL2L10      -------------acccccgagccgag-------------gccgtccacg
A0A2K6KRW9_MCL1-02      agcgccggcgcaagccccccggccg-----------------ccctcacg
A0A2K6KRW9_MCL1-01      agcgccggcgcaagccccccggccg-----------------ccctcacg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      cccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccg
A0A2K6ME72_BCL2L2-      ----------agggcccagcagctgac-----------------ccgctg
A0A2K6ME72_BCL2L2-      ----------agggcccagcagctgac-----------------ccgctg
                                                                          

A0A2K6LV19_BCL2A1-      caaaacgtccagagtgctac----------aaaaggttgcattctcagtc
A0A2K6LV19_BCL2A1-      caaaacgtccagagtgctac----------aaaaggttgcattctcagtc
A0A2K6M5H5_BCL2L10      cccgaggcc------gccgt------------------------------
A0A2K6KRW9_MCL1-02      ccagacgcccggagggtcgc------------------------------
A0A2K6KRW9_MCL1-01      ccagacgcccggagggtcgc------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctc
A0A2K6ME72_BCL2L2-      caccaagccatgcgggca--------------------------------
A0A2K6ME72_BCL2L2-      caccaagccatgcgggca--------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      cagaaagaagtggaaaagaatctgaagccatgcttggacaatgttaatg-
A0A2K6LV19_BCL2A1-      cagaaagaagtggaaaagaatctgaagccatgcttggacaatgttaatg-
A0A2K6M5H5_BCL2L10      ------gctg----cgctccgcggcggccaggttacggcagctccaccgg
A0A2K6KRW9_MCL1-02      ------gcggccgccgcccattggcgccgaggtccc--cgacgtcaccgg
A0A2K6KRW9_MCL1-01      ------gcggccgccgcccattggcgccgaggtccc--cgacgtcaccgg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      cgccaggccggtgacgacttctcccgccgctaccgccgcgacttcgccga
A0A2K6ME72_BCL2L2-      ------gctggagatgagttcgagacccgcttccggcgcaccttctctga
A0A2K6ME72_BCL2L2-      ------gctggagatgagttcgagacccgcttccggcgcaccttctctga
                                                                          

A0A2K6LV19_BCL2A1-      -----------------------ttgcatccatagacactgccagaacac
A0A2K6LV19_BCL2A1-      -----------------------ttgcatccatagacactgccagaacac
A0A2K6M5H5_BCL2L10      tccttc-------------ttctctgcctacctcggctaccccgggaacc
A0A2K6KRW9_MCL1-02      gacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctc
A0A2K6KRW9_MCL1-01      gacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      gatgtccagccagctgca----cctgacgcccttcaccgcgcggggacgc
A0A2K6ME72_BCL2L2-      tctggcggctcagctgca----tgtgaccccaggctcagcgcagcaacgc
A0A2K6ME72_BCL2L2-      tctggcggctcagctgca----tgtgaccccaggctcagcgcagcaacgc
                                                                          

A0A2K6LV19_BCL2A1-      tattcaatcaag------tgatggaaaagga-------------------
A0A2K6LV19_BCL2A1-      tattcaatcaag------tgatggaaaagga-------------------
A0A2K6M5H5_BCL2L10      gcgtcgagctggtggcgctgatggcggaggccgt----------------
A0A2K6KRW9_MCL1-02      ttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagag
A0A2K6KRW9_MCL1-01      ttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      tt-----------tgccacggtggtggagga-------------------
A0A2K6ME72_BCL2L2-      tt-----------cacccaggtctctgatga-------------------
A0A2K6ME72_BCL2L2-      tt-----------cacccaggtctctgatga-------------------
                                                                          

A0A2K6LV19_BCL2A1-      ------------------------gtttgaagatggc------------a
A0A2K6LV19_BCL2A1-      ------------------------gtttgaagatggc------------a
A0A2K6M5H5_BCL2L10      ------------------------gctctccgacagc---------cccg
A0A2K6KRW9_MCL1-02      gagctggacgggtacgagccggagcctctcgggaagcggccggctgtcct
A0A2K6KRW9_MCL1-01      gagctggacgggtacgagccggagcctctcgggaagcggccggctgtcct
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ------------------------gctcttcagggac------------g
A0A2K6ME72_BCL2L2-      ------------------------acttttccaaggg------------g
A0A2K6ME72_BCL2L2-      ------------------------acttttccaaggg------------g
                                                                          

A0A2K6LV19_BCL2A1-      tcattaactggggaagaattgtaaccatattt------------------
A0A2K6LV19_BCL2A1-      tcattaactggggaagaattgtaaccatattt------------------
A0A2K6M5H5_BCL2L10      gccccacctggggcagggtggtgtcgctggtg------------------
A0A2K6KRW9_MCL1-02      gcccctgctggagttggtcggggaatctggtaatagctccagtacggatg
A0A2K6KRW9_MCL1-01      gcccctgctggagttggtcggggaatctggtaatagctccagtacggatg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      gggtgaactgggggaggattgtggccttcttt------------------
A0A2K6ME72_BCL2L2-      gccccaactggggccgccttgtagccttcttt------------------
A0A2K6ME72_BCL2L2-      gccccaactggggccgccttgtagccttcttt------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagttg
A0A2K6KRW9_MCL1-01      ggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagttg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      -------------------------------gcatttgaaggtattct--
A0A2K6LV19_BCL2A1-      -------------------------------gcatttgaaggtattct--
A0A2K6M5H5_BCL2L10      -------------------------------accttcgcggggacgctgc
A0A2K6KRW9_MCL1-02      taccggcagtcactggaaattatctctcggtaccttcgggagcaggccac
A0A2K6KRW9_MCL1-01      taccggcagtcactggaaattatctctcggtaccttcgggagcaggccac
A0A2K6KRW9_MCL1-03      --------------------------------------------ggccac
A0A2K6KHG1_BCL2-01      -------------------------------gagttcggtggggtcatgt
A0A2K6ME72_BCL2L2-      -------------------------------gtctttggggctgcactgt
A0A2K6ME72_BCL2L2-      -------------------------------gtctttggggctgcactgt
                                                                          

A0A2K6LV19_BCL2A1-      --catcaagaaacttctacgacagcaaattgccccggatgtggatactta
A0A2K6LV19_BCL2A1-      --catcaagaaacttctacgacagcaaattgccccggatgtggatactta
A0A2K6M5H5_BCL2L10      tggagagagagccgctggtgacagcctggtggaagaagcggagcttccag
A0A2K6KRW9_MCL1-02      cggcgccaaggacac-----aaagccaatgggcaggtctggggccaccag
A0A2K6KRW9_MCL1-01      cggcgccaaggacac-----aaagccaatgggcaggtctggggccaccag
A0A2K6KRW9_MCL1-03      cggcgccaaggacac-----aaagccaatgggcaggtctggggccaccag
A0A2K6KHG1_BCL2-01      ----------------------------------gtgtggagagcgtcaa
A0A2K6ME72_BCL2L2-      ----------------------------------gtgctgagagtgtcaa
A0A2K6ME72_BCL2L2-      ----------------------------------gtgctgagagtgtcaa
                                                               *          

A0A2K6LV19_BCL2A1-      taa---------ggagatttcgtattttgttgctgag-------------
A0A2K6LV19_BCL2A1-      taa---------ggagatttcgtattttgttgctgag-------------
A0A2K6M5H5_BCL2L10      ccgcgg----ctgaagg------agcaggagggcgacgtcgcccgggact
A0A2K6KRW9_MCL1-02      caggaaggctctggagaccttacgacgggtgggggatggcgtgcag---c
A0A2K6KRW9_MCL1-01      caggaaggctctggagaccttacgacgggtgggggatggcgtgcag---c
A0A2K6KRW9_MCL1-03      caggaaggctctggagaccttacgacgggtgggggatggcgtgcag---c
A0A2K6KHG1_BCL2-01      ccg---------ggagatgtcgcccctggtggacaacatcgccctg----
A0A2K6ME72_BCL2L2-      caa---------ggagatggaaccactggtgggacaagtgcaggag----
A0A2K6ME72_BCL2L2-      caa---------ggagatggaaccactggtgggacaagtgcaggag----
                                    * **            *  *   *              

A0A2K6LV19_BCL2A1-      -----ttcataatgaataacacagga------------------------
A0A2K6LV19_BCL2A1-      -----ttcataatgaataacacagga------------------------
A0A2K6M5H5_BCL2L10      gccagcgcctggtggccttgctgagctcgc--------------------
A0A2K6KRW9_MCL1-02      gcaaccacgagacggctttccaa---------------------------
A0A2K6KRW9_MCL1-01      gcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
A0A2K6KRW9_MCL1-03      gcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
A0A2K6KHG1_BCL2-01      -----tggatgactgagtacctgaaccggc--------------------
A0A2K6ME72_BCL2L2-      -----tggatggtggcctacctggagacgc--------------------
A0A2K6ME72_BCL2L2-      -----tggatggtggcctacctggagacgc--------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      aacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcag
A0A2K6KRW9_MCL1-03      aacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcag
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      cgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtg
A0A2K6KRW9_MCL1-03      cgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtg
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      cctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaa
A0A2K6KRW9_MCL1-03      cctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaa
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      ---------------------------------------------gaatg
A0A2K6LV19_BCL2A1-      ---------------------------------------------gaatg
A0A2K6M5H5_BCL2L10      -------------------------ggctcacggggcagcaccgcgcctg
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      ccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactg
A0A2K6KRW9_MCL1-03      ccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactg
A0A2K6KHG1_BCL2-01      -------------------------------------acctgcacacttg
A0A2K6ME72_BCL2L2-      -------------------------------------ggctggctgactg
A0A2K6ME72_BCL2L2-      -------------------------------------ggctggctgactg
                                                                          

A0A2K6LV19_BCL2A1-      gataaggcaaaacggaggct-ggga-------------------------
A0A2K6LV19_BCL2A1-      gataaggcaaaacggaggctggggg-------------------------
A0A2K6M5H5_BCL2L10      gcttcaggctcagggcggctgggat------ggcttttgtcacttcttc-
A0A2K6KRW9_MCL1-02      ---------------------ggat------gggtttgtggagttcttcc
A0A2K6KRW9_MCL1-01      gctagttaaacaaagaggctgggat------gggtttgtggagttcttcc
A0A2K6KRW9_MCL1-03      gctagttaaacaaagaggctgggat------gggtttgtggagttcttcc
A0A2K6KHG1_BCL2-01      gatccaggataacggaggctgggat------gcctttgtgg---------
A0A2K6ME72_BCL2L2-      gatccacagcagtgggggctgggcg------gagttcacagctctatacg
A0A2K6ME72_BCL2L2-      gatccacagcagtgggggctgggagctggaagctatcaaagctcgagtca
                                             **                           

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      ------aggaccc-------------------------------------
A0A2K6KRW9_MCL1-02      atgtagaggacctagaaggtggcatcag----------------------
A0A2K6KRW9_MCL1-01      atgtagaggacctagaaggtggcatcag----------------------
A0A2K6KRW9_MCL1-03      atgtagaggacctagaaggtggcatcag----------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      gggacggggccctggaggaggcgcggcgtctgcgggag------------
A0A2K6ME72_BCL2L2-      gggagatgga---ggaagaagctgagaagctaaaggagctacagaacgag
                                                                          

A0A2K6LV19_BCL2A1-      ---------------------------------aaa--------------
A0A2K6LV19_BCL2A1-      ---------------------------------aaa--------------
A0A2K6M5H5_BCL2L10      -----------------------------------cctttccgc------
A0A2K6KRW9_MCL1-02      ---------------------------------aaatgtgctgc------
A0A2K6KRW9_MCL1-01      ---------------------------------aaatgtgctgc------
A0A2K6KRW9_MCL1-03      ---------------------------------aaatgtgctgc------
A0A2K6KHG1_BCL2-01      ---------------------------------aactgtacggccccagc
A0A2K6ME72_BCL2L2-      ---gggaactgggcatcagtgag----------gacagtgctgac-----
A0A2K6ME72_BCL2L2-      gtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagt
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      a-----------------------tgcggcctctgtttgatttctcctgg
A0A2K6ME72_BCL2L2-      ------------------------gggggccg------------------
A0A2K6ME72_BCL2L2-      gatcatgtccattgaggagaagatggaggctgatgcccgttccatctatg
                                                                          

A0A2K6LV19_BCL2A1-      -tggctttgtaaagaagtttgaacctaaatct------------------
A0A2K6LV19_BCL2A1-      -tggc-------acaatcacatgcctatg-ct------------------
A0A2K6M5H5_BCL2L10      -tggctttttggagaaaactg---------ct------------------
A0A2K6KRW9_MCL1-02      -tggctttt--gcaggtgttg---------ct------------------
A0A2K6KRW9_MCL1-01      -tggctttt--gcaggtgttg---------ct------------------
A0A2K6KRW9_MCL1-03      -tggctttt--gcaggtgttg---------ct------------------
A0A2K6KHG1_BCL2-01      ctgtctct---gaagactctg---------ct------------------
A0A2K6ME72_BCL2L2-      -tggcact---gggggccctg---------gt------------------
A0A2K6ME72_BCL2L2-      ttggcaat---gtggactatg---------gtgcaacagcagaagagctg
                         ** *                          *                  

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      gaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctg
                                                                          

A0A2K6LV19_BCL2A1-      -----ggctggatgacttt-------------------------------
A0A2K6LV19_BCL2A1-      -----agtagagtcagtgg-------------------------------
A0A2K6M5H5_BCL2L10      -----gatccag--gcttt-------------------------------
A0A2K6KRW9_MCL1-02      -----ggagtaggagctgg-------------------------------
A0A2K6KRW9_MCL1-01      -----ggagtaggagctgg-------------------------------
A0A2K6KRW9_MCL1-03      -----ggagtaggagctgg-------------------------------
A0A2K6KHG1_BCL2-01      ----cagttt---ggccct-------------------------------
A0A2K6ME72_BCL2L2-      ----aactgtaggggcctt-------------------------------
A0A2K6ME72_BCL2L2-      tgacaaatttagtggccatcccaaagggtttgcgtatatagagttctcag
                                                                          

A0A2K6LV19_BCL2A1-      -------tctagaagttacaggaaagatctgtgaaatgct----------
A0A2K6LV19_BCL2A1-      -------cccataggaagaagaaaatggctttgtaa--------------
A0A2K6M5H5_BCL2L10      -----------------------------cctggcatgct----------
A0A2K6KRW9_MCL1-02      -----------------------------tttggcatatc----------
A0A2K6KRW9_MCL1-01      -----------------------------tttggcatatc----------
A0A2K6KRW9_MCL1-03      -----------------------------tttggcatatc----------
A0A2K6KHG1_BCL2-01      ----------ggtgggagcttgcatcaccctgggtgccta----------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      acaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcag
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      cacaacagaccggggttttccacgagcccgctaccgcgcccggaccacca
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      ----------------------------------tgttaacaacagcctt
A0A2K6KRW9_MCL1-02      ----------------------------------taataa----------
A0A2K6KRW9_MCL1-01      ----------------------------------taataa----------
A0A2K6KRW9_MCL1-03      ----------------------------------taataa----------
A0A2K6KHG1_BCL2-01      ----------------------------------tctgggccacaag---
A0A2K6ME72_BCL2L2-      ----------------------------------ttttgctagcaag---
A0A2K6ME72_BCL2L2-      actacaacagttcccgctctcgcttctacagtggttttaacagcaggccc
                                                                          

A0A2K6LV19_BCL2A1-      ---atctctcctgaagcaatactgttga
A0A2K6LV19_BCL2A1-      ----------------------------
A0A2K6M5H5_BCL2L10      cggttacctctggacacgattattatga
A0A2K6KRW9_MCL1-02      ------------gatagccttactgtaa
A0A2K6KRW9_MCL1-01      ------------gatag-----------
A0A2K6KRW9_MCL1-03      ------------gatag-----------
A0A2K6KHG1_BCL2-01      -------------------------tga
A0A2K6ME72_BCL2L2-      -------------------------tga
A0A2K6ME72_BCL2L2-      cggggtcgcgtctacag-gtcaggatag
                                                    

© 1998-2022Legal notice