Dataset for CDS MCL-1 of organism Oreochromis aureus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A668RLC9_MCL1-01      atgaccaactatttgatgtcgaaaaggaaccagtttaccttcatagacta
A0A668SNL1_MCL1-01      ---------------atgt------------------tctccttaaattg
                                       ****                   ** * ** * * 

A0A668RLC9_MCL1-01      tcttcttcctcaaaatggagtcccggagggaccaat----gcactatgga
A0A668SNL1_MCL1-01      ctgtctgtct--gagtggtgtcc---aaacaacgatgtgggctttataga
                           ***  **   * *** ****   *   * * **    **  *** **

A0A668RLC9_MCL1-01      t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
A0A668SNL1_MCL1-01      taattgggaaaccctct--gtaggaaacc---tggtcttgttagg-----
                        *    ****** *****  * ** *  **    * ** * * * *     

A0A668RLC9_MCL1-01      agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcga
A0A668SNL1_MCL1-01      agagacggcatc-----------catcccactttggatggagcagctc--
                        **  **** **             * ***     **  * *  * ***  

A0A668RLC9_MCL1-01      ggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgggagg
A0A668SNL1_MCL1-01      --tcatttcta----------------gaaatct--------------gg
                          * *  ** *                 *** **              **

A0A668RLC9_MCL1-01      aagacggttcgttgccgagcaccccggagtttcatttggacagtgaatcc
A0A668SNL1_MCL1-01      aagacggttcgttgccgagcaccccggagtttcatttggacagtgaatcc

A0A668RLC9_MCL1-01      gacgaggagctggagagagaaacgaaactccttattcacagttttttggg
A0A668SNL1_MCL1-01      gacgaggagctggagagagaaacgaaactcattattcacagttttttggg
                        ****************************** *******************

A0A668RLC9_MCL1-01      tgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
A0A668SNL1_MCL1-01      agactttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
                         ** **********************************************

A0A668RLC9_MCL1-01      aaacgatgaaaagagttgttgcggacgtattagaaaagcacagatacgct
A0A668SNL1_MCL1-01      aaacgatgaaaagagttgttgcggacgtattagaaaagcacagatatgct
                        ********************************************** ***

A0A668RLC9_MCL1-01      tacaacggaatgattaataaactgtcattggatgaaagacacgaggatat
A0A668SNL1_MCL1-01      tacaacggaatgattaataaattgtcattggatgaaagagaagaagatat
                        ********************* ***************** * ** *****

A0A668RLC9_MCL1-01      gtcatttgtcggtgctgtagcgaagagcctctttgcagaccacatgacca
A0A668SNL1_MCL1-01      gtcatt---------tgtagcgaagagcctctttggagaccacacgacca
                        ******         ******************** ******** *****

A0A668RLC9_MCL1-01      actggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
A0A668SNL1_MCL1-01      actggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag

A0A668RLC9_MCL1-01      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaaga
A0A668SNL1_MCL1-01      cacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaaga
                        ******************** ************* ********* *****

A0A668RLC9_MCL1-01      ggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaaca
A0A668SNL1_MCL1-01      gatttctgcatacttgctgtctgaacagcgagactggattatcaaaaaca
                        * *********** ************************** *********

A0A668RLC9_MCL1-01      atgcatgggatggctttgtggagttctttcgagtagcagaccctgagtcc
A0A668SNL1_MCL1-01      atgcatgggatggctttgtggcgttcgttcgagtagcagaccctgagtcg
                        ********************* **** ********************** 

A0A668RLC9_MCL1-01      acggtcaggaacacactcatggcctttgctggatttgctggtattggggc
A0A668SNL1_MCL1-01      atagtcaggaacacactcatggcctttgctggatttgcttgtattggagc
                        *  ************************************ ******* **

A0A668RLC9_MCL1-01      aacactggccctgttgatcaggttctgggatgcattattgtga
A0A668SNL1_MCL1-01      aacactggcactgttgatcag------------------gtga
                        ********* ***********                  ****

© 1998-2021Legal notice