Dataset for CDS BCL-2-like of organism Phocoena sinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9BC20_BCL2A1-      atg--------------------------------accgacagcgaat--
A0A8C9BM97_BCL2L1-      atgt----------ctcag------------agcaatcgggagctggtgg
A0A8C9CJ69_BCL2-01      atggcgcacg----ctgggagaacagggtatgataaccgggagatagtga
A0A8C9CXQ5_BCL2L2-      atggcgaccccagcctcggcccc-a------gacacacgggctctagtgg
A0A8C9BA52_MCL1-01      atg-----------ttcggcctcaa------gagaaacg-----cagtga
A0A8C9BA52_MCL1-02      atg-----------ttcggcctcaa------gagaaacg-----cagtga
                        ***                                  **        *  

A0A8C9BC20_BCL2A1-      -ttggctatat---tcacatgctggcccag---gacta------------
A0A8C9BM97_BCL2L1-      -ttgactttctctcctacaagctttcccagaaaggatacagctggagtca
A0A8C9CJ69_BCL2-01      -tgaagtacatccactataagctgtcgcagaggggctacgagtgg-----
A0A8C9CXQ5_BCL2L2-      -cagactttgtaggctataagctgaggcagaagggttatgtttgt-----
A0A8C9BA52_MCL1-01      tcggact---caacctctactgtgggggggccggattgggaccgg-----
A0A8C9BA52_MCL1-02      tcggact---caacctctactgtgggggggccggattgggaccgg-----
                              *           *   *      *   *  *             

A0A8C9BC20_BCL2A1-      ----------------------------------cctgaagtacgtcttg
A0A8C9BM97_BCL2L1-      gtttagcgatgtggacgagaacagaactgaggccccagaagggactgaat
A0A8C9CJ69_BCL2-01      -------gatgccggagacgcgggcgccacgtccccgggggccgcccc--
A0A8C9CXQ5_BCL2L2-      -------ggagctg-----------------gccccggggagggccc---
A0A8C9BA52_MCL1-01      -------atagcggcagc----ggcgcctccgctccgggaaggcgacttt
A0A8C9BA52_MCL1-02      -------atagcggcagc----ggcgcctccgctccgggaaggcgacttt
                                                          ** *            

A0A8C9BC20_BCL2A1-      cagatac-------------------------------------------
A0A8C9BM97_BCL2L1-      cagacatgga----------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      tggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaa
A0A8C9BA52_MCL1-02      t-------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      gccggcgaggtgattggcggaagcgccggcccgagccccccagccactct
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      cgcggccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      gccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacc
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      cgccgcgcctcgccgcccgaagagatggaatcctcggtctccgacgccat
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      catgtcgcccgaagaggagctggacgggtgcgagccggagcctctaggga
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      agcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaac
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      agcccgggcaaggacggctcactcccctcgacgccgcccccagcagagga
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8C9BA52_MCL1-01      ggaggaggacgagttgtaccggcagtccctggagattatctctcgatacc
A0A8C9BA52_MCL1-02      --------------------------------------------------
                                                                          

A0A8C9BC20_BCL2A1-      ----------cgcaacctggatctggt---ccaagcaaa-----------
A0A8C9BM97_BCL2L1-      ----------aacccccagtgccatcaatggcaacccgt---cctggcac
A0A8C9CJ69_BCL2-01      ----------cgcgccgggcatcttctcctcccagcctgggagcacccca
A0A8C9CXQ5_BCL2L2-      ----------agcagctg--acccgctgcaccaagccat---gcggg---
A0A8C9BA52_MCL1-01      tccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtct
A0A8C9BA52_MCL1-02      ----------ggcaaccggcaccaaggacgcgaagccactgggcgggtct
                                    *  *      *          * *              

A0A8C9BC20_BCL2A1-      ---acatccag--------------ggtgtta----------caagacgt
A0A8C9BM97_BCL2L1-      ctggcagacag------ccctgcggtgaatggagccactggccacagcag
A0A8C9CJ69_BCL2-01      gcgccatccaggacctccccgccgccgccccaga---ccgctcccgccgc
A0A8C9CXQ5_BCL2L2-      --------cag-------ctggagatgagttcgagacccgcttccggcgc
A0A8C9BA52_MCL1-01      ggggccgccag-------ccggaaa-gcgttagagaccc---tgcgacg-
A0A8C9BA52_MCL1-02      ggggccgccag-------ccggaaa-gcgttagagaccc---tgcgacg-
                                ***               *                    *  

A0A8C9BC20_BCL2A1-      tgctttctcagtccaaaacgaagttgaa----------------aagaat
A0A8C9BM97_BCL2L1-      cagcttggatgcccggga----ggtgatccccatggcagcggtgaagca-
A0A8C9CJ69_BCL2-01      ccccgccagg----gggcctgcgctcagccccgtgccacctgtggtccac
A0A8C9CXQ5_BCL2L2-      accttctcagatctggca----gctcagc-------------tg---cat
A0A8C9BA52_MCL1-01      ---------ggtcggggacggtgtgcaac-------------ggaaccac
A0A8C9BA52_MCL1-02      ---------ggtcggggacggtgtgcaac-------------ggaaccac
                                              *   *                     * 

A0A8C9BC20_BCL2A1-      ttgaaaccatgcttggacaatattgatgttg-------------------
A0A8C9BM97_BCL2L1-      --agcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggc
A0A8C9CJ69_BCL2-01      ctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcga
A0A8C9CXQ5_BCL2L2-      gtgac------cccgggct-------------------------------
A0A8C9BA52_MCL1-01      gagacggccttccaaggca-------------------------------
A0A8C9BA52_MCL1-02      gagacggccttccaaggca-------------------------------
                                       *                                  

A0A8C9BC20_BCL2A1-      -----------------------tgtcc---atagacaccgccaga----
A0A8C9BM97_BCL2L1-      attcagcgacctga---------catcccagctccacatcacccca--gg
A0A8C9CJ69_BCL2-01      cttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggg
A0A8C9CXQ5_BCL2L2-      -----------------------cggcccagcaacgcttcacccag----
A0A8C9BA52_MCL1-01      -----------------------tgcttcggaaactggacatcaaaaacg
A0A8C9BA52_MCL1-02      -----------------------tgcttcggaaactggacatcaaaaacg
                                                               *  *       

A0A8C9BC20_BCL2A1-      -----------acaatattcaaccaagtgatggaaagggaatttgaagat
A0A8C9BM97_BCL2L1-      gacggcatatcagagctttg-agcaggtagtgaacgaactcttccgggat
A0A8C9CJ69_BCL2-01      gacg-----------ctttgccac-ggtggtggaggagctcttcagggat
A0A8C9CXQ5_BCL2L2-      -------------------gtctctgatga------actcttccaa----
A0A8C9BA52_MCL1-01      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgac
A0A8C9BA52_MCL1-02      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgac
                                               *   *             *        

A0A8C9BC20_BCL2A1-      ggcatcgttaac---ggaaggattgtgaccatatttgcatttgaaggcat
A0A8C9BM97_BCL2L1-      ggggtg---aactggggtcgcattgtggcctttttctccttcggtggggc
A0A8C9CJ69_BCL2-01      ggagta---aactgggggaggatcgtggccttctttgagttcggtggggt
A0A8C9CXQ5_BCL2L2-      ggggggcccaactggggccgccttgtggctttctttgtctttggagccgc
A0A8C9BA52_MCL1-01      ggagtaacaaactggggcaggattgtgactctcatttcttttggtgc---
A0A8C9BA52_MCL1-02      ggagtaacaaactggggcaggattgtgactctcatttcttttggtgc---
                        **       ***   **  *  * *** *  *  *    ** *  *    

A0A8C9BC20_BCL2A1-      tctcatcaagaaacttctaggagggcgaattgccccag--------atgt
A0A8C9BM97_BCL2L1-      actgtgcg----------tggaaagcg--tagacaaggag------atgc
A0A8C9CJ69_BCL2-01      catgtgtg----------tggagagcg--tcaaccgggag------atgt
A0A8C9CXQ5_BCL2L2-      gctgtgtg----------ctgagagtg--tcaacaaggag------atgg
A0A8C9BA52_MCL1-01      -ctttgtggccaaacacttgaagagta--taaaccaagaaagctgcatcg
A0A8C9BA52_MCL1-02      -ctttgtggccaaacacttgaagagta--taaaccaagaaagctgcatcg
                          *                  *  *    *   *   *        **  

A0A8C9BC20_BCL2A1-      ggacacttacaaggag-atttcttactttgttg-cagagttcataaccaa
A0A8C9BM97_BCL2L1-      aggtattggtgagtcggattgcagct-tggatggccacttacctgaatga
A0A8C9CJ69_BCL2-01      cccccctggtggacaacatcgcc-ctgtggatgactgagtacctgaaccg
A0A8C9CXQ5_BCL2L2-      agccacttgtgggaca-agtgcaggagtggatggtggcctacctggagac
A0A8C9BA52_MCL1-01      aaccattagcagaaagcatcacagatgttctcgtaaggaca-----aaac
A0A8C9BA52_MCL1-02      aaccattagcagaaagcatcacagatgttctcgtaaggaca-----aaac
                              *          *   *     *    *                 

A0A8C9BC20_BCL2A1-      aaacacaggagaatggataaggcagaatggaggctgggaaa-----atgg
A0A8C9BM97_BCL2L1-      ccacctagagccttggatccaggagaacggcggctgggacactttcgtgg
A0A8C9CJ69_BCL2-01      acacctgcacacctggatccaggataacggaggctgggatgcctttgtgg
A0A8C9CXQ5_BCL2L2-      gcggctggccgactggatccacagcagcgggggctgggcggagttcacag
A0A8C9BA52_MCL1-01      gagactggctagtcaaacaaa--------gaggctgggatgggtttgtgg
A0A8C9BA52_MCL1-02      gagactggctagtcaaacaaa--------gaggctgggatgggtttgtgg
                                        *            * *******           *

A0A8C9BC20_BCL2A1-      ctttgtaaagaagtttgaacccaagtctggctggctgacttttctggaag
A0A8C9BM97_BCL2L1-      aactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgc
A0A8C9CJ69_BCL2-01      agctgtac--------ggtcccagcat----gcg---gcctctgtttgat
A0A8C9CXQ5_BCL2L2-      ctctatacggggacggggccctggaggaggcgcg---gcgtctgcgggag
A0A8C9BA52_MCL1-01      acttcttccacgtagaggacctagaag----gcg---gcatc--------
A0A8C9BA52_MCL1-02      acttcttccacgtagaggacctagaag----gcg---gcatc--------
                           * *                           *                

A0A8C9BC20_BCL2A1-      ttacaggaaagatctgtgaaa--------tattatgtctcctgaagcagt
A0A8C9BM97_BCL2L1-      ttcaaccgctggttcctgacgggcat---------gactgtggctggcgt
A0A8C9CJ69_BCL2-01      ttctcctggctgtctctgaaggcactgctcagtctggccctggt---ggg
A0A8C9CXQ5_BCL2L2-      gggaactgggcctcagtgaggacagtgctgacgggggccgtggcactggg
A0A8C9BA52_MCL1-01      ------------------agaaatgtgctgct---ggcttttgca--ggt
A0A8C9BA52_MCL1-02      ------------------agaaatgtgctgct---ggcttttgca--ggt
                                          *                * *    *     * 

A0A8C9BC20_BCL2A1-      actattga--------------------------------------
A0A8C9BM97_BCL2L1-      ggttctg------ctgggctcgctcttca-----gtcggaaatga-
A0A8C9CJ69_BCL2-01      agcttgcatcaccctgggtgcctatctgg-----gccataagtga-
A0A8C9CXQ5_BCL2L2-      ggccctggtaactgtaggggccttttttg-----ctagcaagtga-
A0A8C9BA52_MCL1-01      gttgccgg----agtaggagctggtttggcgtatctaataagatag
A0A8C9BA52_MCL1-02      gttgccgg----agtaggagctggtttggcgtatctaataagatag
                                                                      

© 1998-2023Legal notice