Dataset for CDS BAX-like of Organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


K4FTK7_BOK-01       atggacatgttacggcgctcctcggtctttgctgctgaggtga----tggaggtgtttga
V9L3D5_BAK1-01      atggcaa--------------------cttggagcagttgtgacccgtgcaggt-----c
                    ****  *                     ***  ** *  ****    ** ****      

K4FTK7_BOK-01       acgttctccccctgacaaggagctc---------------------------gtttctca
V9L3D5_BAK1-01      atgttcaccacatgaagagaagagcagcgaagcagacgcagagcagaacatggtaaaaga
                    * **** ** * ***  ** **  *                           **     *

K4FTK7_BOK-01       ggctaaagccctctgtcgggattacatccact-------cccggctgatcc----gagca
V9L3D5_BAK1-01      agcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagag
                     **  * *   *** **** ****  ** **        **   ****       ***  

K4FTK7_BOK-01       ggcatagtctgga---gcaaacctgagtgtgcagca---gccagcccagc--cag-----
V9L3D5_BAK1-01      agtacaggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgg
                     * * **  ****   * **  * *    ****  *   * *** *** *  ***     

K4FTK7_BOK-01       ---caaactcac--------tgaggtgtcagctgcactcctccgcctgg----gtgatga
V9L3D5_BAK1-01      gctcagttccacaatgcagatagggcgtcagctg----gctgtgattggagatgagatca
                       **    ***        *  ** ********     **  *  ***    * *** *

K4FTK7_BOK-01       attagagtacatcaggccgaacatgtacaggaatgtcgccaaacagttgaat--atcacc
V9L3D5_BAK1-01      atcagcg-------------atacaagtgggagtttcggagtgtgctggcatggaacgca
                    ** ** *             * *      *** * ***        * * **  * * * 

K4FTK7_BOK-01       gtcagttccgaaagcatcgtatcggatgcatttctcgctgtggccactgagatcttctct
V9L3D5_BAK1-01      ctcacacttgagaatatc---ttcgagtccttctgcagtgttgctgaaaggctgtttgat
                     ***     ** *  ***   *  **  * **   *  *** **      * * **   *

K4FTK7_BOK-01       gcaggtataacttgggggaaggtggtagccttgtatgctgttgccggtggacttgccatt
V9L3D5_BAK1-01      gctgggatcaactggggccaaatcattgctctgctgagttttggctacaggatgtcaatt
                    ** ** ** *  *****  *  *  * **  **     * *** *    *  *  * ***

K4FTK7_BOK-01       gactgtgtgaaacaagggcaacctgccatggtgc-acacaatagttgactgcctgggaga
V9L3D5_BAK1-01      tac-atccatcagagaggaatcttgggattttttggcagaattgcaaagtatgtcgcaaa
                     **  *     * *  ** * * **  **  *    ** *** *   * *   * * * *

K4FTK7_BOK-01       atttgtgcggaagacactggtgac---ttggctccggagacggggaggatgg---gctga
V9L3D5_BAK1-01      gtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctggaccgctgc
                     *** *  ******  *   *  *    *** **  *   * ****** ***   **** 

K4FTK7_BOK-01       cattacaaaatccgtggtgaacaacgatcct-agcattcgtgatcactggctcgtctctg
V9L3D5_BAK1-01      cttt------tccgtggagaatgccagcctgaagtatctgtg----cggcatcgtggctg
                    * **      ******* ***   *   *   ** **  ***    * *  ****  ***

K4FTK7_BOK-01       ccgt----ctgcacgtttggacactttgtgaaagcggtcttcttctttctgctgcgagaa
V9L3D5_BAK1-01      tggtagtgctgggcg--tggcca--ttgcccacggggttt------------------ac
                      **    ***  **  *** **  ***   * * *** *                  * 

K4FTK7_BOK-01       cggtga
V9L3D5_BAK1-01      aagtaa
                      ** *

© 1998-2020Legal notice