Dataset for CDS BAX-like of Organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W3IZA3_BOK-01       atg-----------------tctgatcttgcaggtttaatgctgagtatc
K4FTK7_BOK-01           --------------------------------------------------
A0A4W3KFA8_BAX-01       --------------------------------------------------
A0A4W3JVN7_BAK1-01      atg-----------------------------------------------
A0A4W3JNU0_BAX-01       --------------------------------------------------
A0A4W3JNU0_BAX-02       --------------------------------------------------
A0A4W3JFN9_BAX-01       atg-------------------aaaggaccgagagt-cagagagagcagt
A0A4W3KJU8_BAK1-03      atgtctccagaatcatcttccctcaccttcaggagcacaaaaaaaacatt
A0A4W3KJU8_BAK1-01      atg-------------------gcaactt--ggagca-------------
                                                                          

A0A4W3IZA3_BOK-01       tttggtgtacctgtcacaggtttgatcattttgatctctcatttactatc
K4FTK7_BOK-01           --------------------------------------------------
A0A4W3KFA8_BAX-01       --------------------------------------------------
A0A4W3JVN7_BAK1-01      ----------gcctcaggcggaga--------------------------
A0A4W3JNU0_BAX-01       --------------------------------------------------
A0A4W3JNU0_BAX-02       -----------------------------------------ggcttcagg
A0A4W3JFN9_BAX-01       gactcactggatgctacgcggaagttaccagcgatcacacagtcttgtct
A0A4W3KJU8_BAK1-03      gccgagtgttgtgctagttgcacaacagt----ataatataattaaggta
A0A4W3KJU8_BAK1-01      -------gttgtgacccgtgcaggtca-----------------------
                                                                          

A0A4W3IZA3_BOK-01       ttctcagatgga--------catgttacggcgctcctcggtctttgc---
K4FTK7_BOK-01           -------atgga--------catgttacggcgctcctcggtctttgc---
A0A4W3KFA8_BAX-01       ---------------tttatcatgg-----------------agcgcc--
A0A4W3JVN7_BAK1-01      --------tggagatcccttc-----------agatccaatctaccca--
A0A4W3JNU0_BAX-01       ---------------tttatcatgg-----------------atcgca--
A0A4W3JNU0_BAX-02       tcgcgcgttgacgggtttatcatgg-----------------atcgca--
A0A4W3JFN9_BAX-01       tgttgttttggaggtgttttcctggctgttcaaactcaaatcctcccgag
A0A4W3KJU8_BAK1-03      caatctgttg--------ttcgtggcaaggcgccatcaagtaactgcg--
A0A4W3KJU8_BAK1-01      --------tg--------ttc---------------------accaca--
                                            *                         *   

A0A4W3IZA3_BOK-01       ----------tgctgaggtgatggaggtgtttgaacgttctccccctga-
K4FTK7_BOK-01           ----------tgctgaggtgatggaggtgtttgaacgttctccccctga-
A0A4W3KFA8_BAX-01       ----------tgagcag---------------------------------
A0A4W3JVN7_BAK1-01      -------------ggaaccgaaagaaccttcacaggcgtccttcaaggc-
A0A4W3JNU0_BAX-01       ----------cgcagag---------------------------------
A0A4W3JNU0_BAX-02       ----------cgcagag---------------------------------
A0A4W3JFN9_BAX-01       ggtttaccatcgcagagtttgcagtaactttgcatcgactttgcggtggg
A0A4W3KJU8_BAK1-03      ----------tgagaaatagtcagggcccactaaatgactttgcctttat
A0A4W3KJU8_BAK1-01      ----------tgaagag-----aagagcagcgaag---------------
                                       *                                  

A0A4W3IZA3_BOK-01       --------------------------------------------------
K4FTK7_BOK-01           --------------------------------------------------
A0A4W3KFA8_BAX-01       --------------------------------------------------
A0A4W3JVN7_BAK1-01      --------------------------------------------------
A0A4W3JNU0_BAX-01       --------------------------------------------------
A0A4W3JNU0_BAX-02       --------------------------------------------------
A0A4W3JFN9_BAX-01       gggtgcggtgtgggggtttgcgggaggggct-------------------
A0A4W3KJU8_BAK1-03      ttgtttactgttcttatctgaattgatgactctccagtcggtttactttc
A0A4W3KJU8_BAK1-01      --------------------------------------------------
                                                                          

A0A4W3IZA3_BOK-01       ----------------caaggagctcgtttctcaggctaaagccctctgt
K4FTK7_BOK-01           ----------------caaggagctcgtttctcaggctaaagccctctgt
A0A4W3KFA8_BAX-01       -aagcaccgagcagttcggggtgt--------------------------
A0A4W3JVN7_BAK1-01      ctgtcacagaggaaggcgttgtacaagagactgaagagg------ttttc
A0A4W3JNU0_BAX-01       -aggtgccgaggactgcgaggtgctcg-----------------------
A0A4W3JNU0_BAX-02       -aggtgccgaggactgcgaggtgctcg-----------------------
A0A4W3JFN9_BAX-01       cagccatggagagcttcagggcatcaggagctgctgatggaagactgagt
A0A4W3KJU8_BAK1-03      cacccacagagcagaacatggtaaaagaagcagaggatg------tcttt
A0A4W3KJU8_BAK1-01      cagacgcagagcagaacatggtaaaagaagcagaggatg------tcttt
                                        *   *                             

A0A4W3IZA3_BOK-01       cgggattacatccactc----ccggctgatccgagcaggcatagtc---t
K4FTK7_BOK-01           cgggattacatccactc----ccggctgatccgagcaggcatagtc---t
A0A4W3KFA8_BAX-01       ------------------------ccctggctaacttggggccatttccg
A0A4W3JVN7_BAK1-01      agaagctatgtctt-------tttccggtaccagaccgaga----g---g
A0A4W3JNU0_BAX-01       ---------------------tcaccgtgtccgacctggggggccg---g
A0A4W3JNU0_BAX-02       ---------------------tcaccgtgtccgacctggggggccg---g
A0A4W3JFN9_BAX-01       cgggaggaaggtgacagagctccag-attcctcggatgagatcctt---a
A0A4W3KJU8_BAK1-03      cggaattatgtcta-------ccagcgttaccaaactgagg----t---a
A0A4W3KJU8_BAK1-01      cggaattatgtcta-------ccagcgttaccaaactgagg----t---a
                                                      *      *            

A0A4W3IZA3_BOK-01       ggagcaaacctgagtgt-------------gcagcagccagcccagccag
K4FTK7_BOK-01           ggagcaaacctgagtgt-------------gcagcagccagcccagccag
A0A4W3KFA8_BAX-01       caggacacggggaccgc---------------------ccacccccactt
A0A4W3JVN7_BAK1-01      gaagaaggagggaatgt-------------------cccagaggatccag
A0A4W3JNU0_BAX-01       gcagacgagctgaataa------------------------accctgctt
A0A4W3JNU0_BAX-02       gcagacgagctgaataa------------------------accctgctt
A0A4W3JFN9_BAX-01       tgagacaagctggaggactcatgcgtagatttgtgctggagacaatccat
A0A4W3KJU8_BAK1-03      gaagagagagtacagga--------tggatttgtaacaccggccatgcaa
A0A4W3KJU8_BAK1-01      gaagagagagtacagga--------tggatttgtaacaccggccatgcaa
                           *                                           *  

A0A4W3IZA3_BOK-01       caaact--------------cactgaggtgtcagctgcactcctccgcct
K4FTK7_BOK-01           caaact--------------cactgaggtgtcagctgcactcctccgcct
A0A4W3KFA8_BAX-01       gaaggg-----------------------------------------aat
A0A4W3JVN7_BAK1-01      aaatagcagagatgcatcaatcacctgaa---agcaccacagctcttgtt
A0A4W3JNU0_BAX-01       gaa--g--a-------------------------------------ggct
A0A4W3JNU0_BAX-02       gaa--g--a-------------------------------------ggct
A0A4W3JFN9_BAX-01       gaa--g--aagatccagaaa----tttcactcag--ccccgatg--aact
A0A4W3KJU8_BAK1-03      gaaatg--acagtccaacaacagtctgggctcagttccacaatgcagata
A0A4W3KJU8_BAK1-01      gaaatg--acagtccaacaacagtctgggctcagttccacaatgcagata
                         **                                               

A0A4W3IZA3_BOK-01       gggtgatgaat---------------------------------------
K4FTK7_BOK-01           gggtgatgaat---------------------------------------
A0A4W3KFA8_BAX-01       gagcgattctc---------------------------------------
A0A4W3JVN7_BAK1-01      ggacggca-gcttgctgtcattggaga-----------------------
A0A4W3JNU0_BAX-01       gggtg----tctgcctgcgacag---------------------------
A0A4W3JNU0_BAX-02       gggtg----tctgcctgcgacag---------------------------
A0A4W3JFN9_BAX-01       gggcggcactcagagtgagattgatgatcctaccatcaagcatgtaaccc
A0A4W3KJU8_BAK1-03      gggcgtca-gctggctgtgattggaga-----------------------
A0A4W3KJU8_BAK1-01      gggcgtca-gctggctgtgattggaga-----------------------
                        *   *                                             

A0A4W3IZA3_BOK-01       ------tagagtacatcaggccgaacatgtacaggaatgtcgccaaacag
K4FTK7_BOK-01           ------tagagtacatcaggccgaacatgtacaggaatgtcgccaaacag
A0A4W3KFA8_BAX-01       ------tgagaaggatcggggatttgctcagcaatgacaccaagctgcag
A0A4W3JVN7_BAK1-01      ------tgacatcaaccgcagatacg----------atttagagttccac
A0A4W3JNU0_BAX-01       --------------atcggggatgagctggacggcaacgtggagttgcaa
A0A4W3JNU0_BAX-02       --------------atcggggatgagctggacggcaacgtggagttgcaa
A0A4W3JFN9_BAX-01       agtgtttgaggacaattggggatgaactgaacagaaatgttgaactgcag
A0A4W3KJU8_BAK1-03      ------tgagatcaatcagcgataca---agtgggagtttcggagtgtgc
A0A4W3KJU8_BAK1-01      ------tgagatcaatcagcgataca---agtgggagtttcggagtgtgc
                                      *                                   

A0A4W3IZA3_BOK-01       ttgaatatcaccgtcagttccg-aaagc------atcgtatcggatgcat
K4FTK7_BOK-01           ttgaatatcaccgtcagttccg-aaagc------atcgtatcggatgcat
A0A4W3KFA8_BAX-01       cagggaattgctcacatgagcgactgct----------ccaaggaaacct
A0A4W3JVN7_BAK1-01      aatctgct-gtcaaccttgccactcaacgccgagaatgcgtatgactact
A0A4W3JNU0_BAX-01       aggatgatcaacaggatttcca-ccagc------tgccccaaagagacct
A0A4W3JNU0_BAX-02       aggatgatcaacaggatttcca-ccagc------tgccccaaagagacct
A0A4W3JFN9_BAX-01       tgcctgattgacagcattccta-tcaat------tctgcccgagatgttt
A0A4W3KJU8_BAK1-03      tggc--atggaacgcactcacacttgag------aatatcttcgagtcct
A0A4W3KJU8_BAK1-01      tggc--atggaacgcactcacacttgag------aatatcttcgagtcct
                               *                                   **    *

A0A4W3IZA3_BOK-01       ttctcgctgtggccactgagatcttctctgcaggt---ataacttggggg
K4FTK7_BOK-01           ttctcgctgtggccactgagatcttctctgcaggt---ataacttggggg
A0A4W3KFA8_BAX-01       tcttcaaagtggccgaggaggttttctctgacggcgtcgtcaactggggc
A0A4W3JVN7_BAK1-01      tccgcaaaatagctctcgggctttttgaaagtggt---attaactggggc
A0A4W3JNU0_BAX-01       tcttccaagtggccaaggagctgttttccgatggagtcatcaactgggga
A0A4W3JNU0_BAX-02       tcttccaagtggccaaggagctgttttccgatggagtcatcaactgggga
A0A4W3JFN9_BAX-01       tgtgccaagtagctggaaagctcatttctgatgaa---ttgaactgggga
A0A4W3KJU8_BAK1-03      tctgcagtgttgctgaaaggctgtttgatgctggg---atcaactggggc
A0A4W3KJU8_BAK1-01      tctgcagtgttgctgaaaggctgtttgatgctggg---atcaactggggc
                        *   *    * **      * *  *       *      * *  ***** 

A0A4W3IZA3_BOK-01       aaggtggtagccttgtatgctgttgccggtggacttgccattgactgtgt
K4FTK7_BOK-01           aaggtggtagccttgtatgctgttgccggtggacttgccattgactgtgt
A0A4W3KFA8_BAX-01       cgagtggtcatgctcttcatcttcgcctgcatcttggtg-ctgaaggcgc
A0A4W3JVN7_BAK1-01      cgtgtgat----------agctctcctg--ggctttggt-tatcgaatgg
A0A4W3JNU0_BAX-01       cgagtggtcactctcttctactttgcctgcaagttcgtc-gtcaaggccg
A0A4W3JNU0_BAX-02       cgagtggtcactctcttctactttgcctgcaagttcgtc-gtcaaggccg
A0A4W3JFN9_BAX-01       agaattgtgtccttcttctactttgccggtaaacttatt-tacaaggcac
A0A4W3KJU8_BAK1-03      caaatcat----------tgctctgctg--agttttggc-tacaggatgt
A0A4W3KJU8_BAK1-01      caaatcat----------tgctctgctg--agttttggc-tacaggatgt
                            *  *                 *        *               

A0A4W3IZA3_BOK-01       gaaacaagggcaacctgc----catggtgcacaca---------atagtt
K4FTK7_BOK-01           gaaacaagggcaacctgc----catggtgcacaca---------atagtt
A0A4W3KFA8_BAX-01       tgacccagtccatcccca---acattatccaaacc---------gtcatc
A0A4W3JVN7_BAK1-01      ctctttacgtcttccagaggggtataaagggattcatcagtcaaattgca
A0A4W3JNU0_BAX-01       tgtgccaga---agctcccagagctgatccagacc---------ataatc
A0A4W3JNU0_BAX-02       tgtgccaga---agctcccagagctgatccagacc---------ataatc
A0A4W3JFN9_BAX-01       tgatgcaaa---atctgagaggaatgatccaacct---------attatt
A0A4W3KJU8_BAK1-03      caatttacatccatcagagaggaatcttgggattttttggcagaattgca
A0A4W3KJU8_BAK1-01      caatttacatccatcagagaggaatcttgggattttttggcagaattgca
                              *       *         *                    *    

A0A4W3IZA3_BOK-01       gactgcctgggagaatttgtgcggaagacactggtgact---tggctccg
K4FTK7_BOK-01           gactgcctgggagaatttgtgcggaagacactggtgact---tggctccg
A0A4W3KFA8_BAX-01       agttggaccatggagtttatgcagagatat---gtcctgcagtggatcca
A0A4W3JVN7_BAK1-01      aagttcgttgccgaatttgttttgagaaatcgaattgcacggtggattgc
A0A4W3JNU0_BAX-01       acgtggactctggaatacatccaagagaat---atcctccagtggatccg
A0A4W3JNU0_BAX-02       acgtggactctggaatacatccaagagaat---atcctccagtggatccg
A0A4W3JFN9_BAX-01       aattggtccttggattttatcc---aaaaccgtgtggttccatggattca
A0A4W3KJU8_BAK1-03      aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcat
A0A4W3KJU8_BAK1-01      aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcat
                           *         * *   *              *       *** *   

A0A4W3IZA3_BOK-01       gagacggggaggatggg---ctgacattacaaaatccgtggtgaacaacg
K4FTK7_BOK-01           gagacggggaggatggg---ctgacattacaaaatccgtggtgaacaacg
A0A4W3KFA8_BAX-01       aaaccatggtggctgggtaagtgaccat------ctc--ac--aacaaca
A0A4W3JVN7_BAK1-01      agctcagggcggctggg----ttgcagctctggattt--agacaatgttt
A0A4W3JNU0_BAX-01       ggagcacggtggctgggatgctatc---------ctc--gg--caccccg
A0A4W3JNU0_BAX-02       ggagcacggtggctgggatgctatc---------ctc--gg--caccccg
A0A4W3JFN9_BAX-01       gctgcaaggaggttgggagaatatctattcttacttc--gg--aactcca
A0A4W3KJU8_BAK1-03      ggcgcagggaggctggg----tgagtatgc--agtgc--ag--tgtggct
A0A4W3KJU8_BAK1-01      ggcgcagggaggctggaccgctgccttttc--cgtgg--ag--aatgcca
                            *  ** ** ***     *                            

A0A4W3IZA3_BOK-01       atcctagcattcgtgatcactggctcgtc--tctgccgtctgcacg-ttt
K4FTK7_BOK-01           atcctagcattcgtgatcactggctcgtc--tctgccgtctgcacg-ttt
A0A4W3KFA8_BAX-01       acaacaaattacatcgccatttacgcagcgcttttca----------cac
A0A4W3JVN7_BAK1-01      atatg-----aagt----ggatggctgga-attctgg----------ctg
A0A4W3JNU0_BAX-01       acctg-----gcag----actgt--cagc-atcttcatcctgggggtcat
A0A4W3JNU0_BAX-02       acctg-----gcag----actgt--cagc-atcttcatcctgggggtcat
A0A4W3JFN9_BAX-01       acctg-----gcag----atgtttgcggt-cttttcagctag-----cat
A0A4W3KJU8_BAK1-03      gcatattattatac----aattatgca-----catta--tta-----tac
A0A4W3KJU8_BAK1-01      gcctg-----aagt----atctgtgcggc-atcgtgg--ctg-----tgg
                                                                          

A0A4W3IZA3_BOK-01       ggacactttgtgaaagcggtcttcttctttctgctgcg-agaacggtga-
K4FTK7_BOK-01           ggacactttgtgaaagcggtcttcttctttctgctgcg-agaacggtga-
A0A4W3KFA8_BAX-01       caggacaggtcaggaccacccaaggcgcgtatattctc-----atctaa-
A0A4W3JVN7_BAK1-01      tagttctaatg-ggagtatttgtgatccacaagtttta-caggccttaa-
A0A4W3JNU0_BAX-01       cactacc--------ctcgtggtgg----tgcggtgga---agtcttaa-
A0A4W3JNU0_BAX-02       cactacc--------ctcgtggtgg----tgcggtgga---agtcttaa-
A0A4W3JFN9_BAX-01       cattaccgg--------tgttttggc---tttgatgaa-actgacctaa-
A0A4W3KJU8_BAK1-03      aattacataac-aaactcttcatagcatatttgataaatgatcaaataaa
A0A4W3KJU8_BAK1-01      tagtgctgggc-g---tggccattgcccacggggttta----caagtaa-
                             *                            *           * * 

A0A4W3IZA3_BOK-01       ----------------
K4FTK7_BOK-01           ----------------
A0A4W3KFA8_BAX-01       ----------------
A0A4W3JVN7_BAK1-01      ----------------
A0A4W3JNU0_BAX-01       ----------------
A0A4W3JNU0_BAX-02       ----------------
A0A4W3JFN9_BAX-01       ----------------
A0A4W3KJU8_BAK1-03      aatggatcctgtatag
A0A4W3KJU8_BAK1-01      ----------------
                                        

© 1998-2020Legal notice