Dataset for CDS BAX-like of Organism Callorhinchus milii

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A4W3IZA3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Callorhinchus milii GN=BOK (length=732 residues).
atgtctgatcttgcaggtttaatgctgagtatctttggtgtacctgtcacaggtttgatcattttgatctctcatttact
atcttctcagatggacatgttacggcgctcctcggtctttgctgctgaggtgatggaggtgtttgaacgttctccccctg
acaaggagctcgtttctcaggctaaagccctctgtcgggattacatccactcccggctgatccgagcaggcatagtctgg
agcaaacctgagtgtgcagcagccagcccagccagcaaactcactgaggtgtcagctgcactcctccgcctgggtgatga
attagagtacatcaggccgaacatgtacaggaatgtcgccaaacagttgaatatcaccgtcagttccgaaagcatcgtat
cggatgcatttctcgctgtggccactgagatcttctctgcaggtataacttgggggaaggtggtagccttgtatgctgtt
gccggtggacttgccattgactgtgtgaaacaagggcaacctgccatggtgcacacaatagttgactgcctgggagaatt
tgtgcggaagacactggtgacttggctccggagacggggaggatgggctgacattacaaaatccgtggtgaacaacgatc
ctagcattcgtgatcactggctcgtctctgccgtctgcacgtttggacactttgtgaaagcggtcttcttctttctgctg
cgagaacggtga
>gnl|bcl2dbcds|A0A4W3JFN9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=837 residues).
atgaaaggaccgagagtcagagagagcagtgactcactggatgctacgcggaagttaccagcgatcacacagtcttgtct
tgttgttttggaggtgttttcctggctgttcaaactcaaatcctcccgagggtttaccatcgcagagtttgcagtaactt
tgcatcgactttgcggtggggggtgcggtgtgggggtttgcgggaggggctcagccatggagagcttcagggcatcagga
gctgctgatggaagactgagtcgggaggaaggtgacagagctccagattcctcggatgagatccttatgagacaagctgg
aggactcatgcgtagatttgtgctggagacaatccatgaagaagatccagaaatttcactcagccccgatgaactgggcg
gcactcagagtgagattgatgatcctaccatcaagcatgtaacccagtgtttgaggacaattggggatgaactgaacaga
aatgttgaactgcagtgcctgattgacagcattcctatcaattctgcccgagatgttttgtgccaagtagctggaaagct
catttctgatgaattgaactggggaagaattgtgtccttcttctactttgccggtaaacttatttacaaggcactgatgc
aaaatctgagaggaatgatccaacctattattaattggtccttggattttatccaaaaccgtgtggttccatggattcag
ctgcaaggaggttgggagaatatctattcttacttcggaactccaacctggcagatgtttgcggtcttttcagctagcat
cattaccggtgttttggctttgatgaaactgacctaa
>gnl|bcl2dbcds|A0A4W3JNU0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=501 residues).
tttatcatggatcgcacgcagagaggtgccgaggactgcgaggtgctcgtcaccgtgtccgacctggggggccgggcaga
cgagctgaataaaccctgcttgaagaggctgggtgtctgcctgcgacagatcggggatgagctggacggcaacgtggagt
tgcaaaggatgatcaacaggatttccaccagctgccccaaagagaccttcttccaagtggccaaggagctgttttccgat
ggagtcatcaactggggacgagtggtcactctcttctactttgcctgcaagttcgtcgtcaaggccgtgtgccagaagct
cccagagctgatccagaccataatcacgtggactctggaatacatccaagagaatatcctccagtggatccgggagcacg
gtggctgggatgctatcctcggcaccccgacctggcagactgtcagcatcttcatcctgggggtcatcactaccctcgtg
gtggtgcggtggaagtcttaa
>gnl|bcl2dbcds|A0A4W3JNU0_BAX-02 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=525 residues).
ggcttcaggtcgcgcgttgacgggtttatcatggatcgcacgcagagaggtgccgaggactgcgaggtgctcgtcaccgt
gtccgacctggggggccgggcagacgagctgaataaaccctgcttgaagaggctgggtgtctgcctgcgacagatcgggg
atgagctggacggcaacgtggagttgcaaaggatgatcaacaggatttccaccagctgccccaaagagaccttcttccaa
gtggccaaggagctgttttccgatggagtcatcaactggggacgagtggtcactctcttctactttgcctgcaagttcgt
cgtcaaggccgtgtgccagaagctcccagagctgatccagaccataatcacgtggactctggaatacatccaagagaata
tcctccagtggatccgggagcacggtggctgggatgctatcctcggcaccccgacctggcagactgtcagcatcttcatc
ctgggggtcatcactaccctcgtggtggtgcggtggaagtcttaa
>gnl|bcl2dbcds|A0A4W3JVN7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=654 residues).
atggcctcaggcggagatggagatcccttcagatccaatctacccaggaaccgaaagaaccttcacaggcgtccttcaag
gcctgtcacagaggaaggcgttgtacaagagactgaagaggttttcagaagctatgtctttttccggtaccagaccgaga
gggaagaaggagggaatgtcccagaggatccagaaatagcagagatgcatcaatcacctgaaagcaccacagctcttgtt
ggacggcagcttgctgtcattggagatgacatcaaccgcagatacgatttagagttccacaatctgctgtcaaccttgcc
actcaacgccgagaatgcgtatgactacttccgcaaaatagctctcgggctttttgaaagtggtattaactggggccgtg
tgatagctctcctgggctttggttatcgaatggctctttacgtcttccagaggggtataaagggattcatcagtcaaatt
gcaaagttcgttgccgaatttgttttgagaaatcgaattgcacggtggattgcagctcagggcggctgggttgcagctct
ggatttagacaatgtttatatgaagtggatggctggaattctggctgtagttctaatgggagtatttgtgatccacaagt
tttacaggccttaa
>gnl|bcl2dbcds|A0A4W3KFA8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=513 residues).
tttatcatggagcgcctgagcagaagcaccgagcagttcggggtgtccctggctaacttggggccatttccgcaggacac
ggggaccgcccacccccacttgaagggaatgagcgattctctgagaaggatcggggatttgctcagcaatgacaccaagc
tgcagcagggaattgctcacatgagcgactgctccaaggaaaccttcttcaaagtggccgaggaggttttctctgacggc
gtcgtcaactggggccgagtggtcatgctcttcatcttcgcctgcatcttggtgctgaaggcgctgacccagtccatccc
caacattatccaaaccgtcatcagttggaccatggagtttatgcagagatatgtcctgcagtggatccaaaaccatggtg
gctgggtaagtgaccatctcacaacaacaacaacaaattacatcgccatttacgcagcgcttttcacaccaggacaggtc
aggaccacccaaggcgcgtatattctcatctaa
>gnl|bcl2dbcds|A0A4W3KJU8_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=828 residues).
atgtctccagaatcatcttccctcaccttcaggagcacaaaaaaaacattgccgagtgttgtgctagttgcacaacagta
taatataattaaggtacaatctgttgttcgtggcaaggcgccatcaagtaactgcgtgagaaatagtcagggcccactaa
atgactttgcctttatttgtttactgttcttatctgaattgatgactctccagtcggtttactttccacccacagagcag
aacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtaca
ggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagatagggc
gtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcactc
acacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatcat
tgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgcaa
agtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctgggtgagtatgcagtgc
agtgtggctgcatattattatacaattatgcacattattatacaattacataacaaactcttcatagcatatttgataaa
tgatcaaataaaaatggatcctgtatag
>gnl|bcl2dbcds|A0A4W3KJU8_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=669 residues).
atggcaacttggagcagttgtgacccgtgcaggtcatgttcaccacatgaagagaagagcagcgaagcagacgcagagca
gaacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtac
aggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagataggg
cgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcact
cacacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatca
ttgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgca
aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctgggtgagtatgcagtg
cagtgtggctgcatattattatacaattatgcacattattatacaattacataacaaactcttcatagcatatttgataa
atgatcaaataaaaatggatcctgtatag
>gnl|bcl2dbcds|A0A4W3KJU8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=648 residues).
atggcaacttggagcagttgtgacccgtgcaggtcatgttcaccacatgaagagaagagcagcgaagcagacgcagagca
gaacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtac
aggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagataggg
cgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcact
cacacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatca
ttgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgca
aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctggaccgctgccttttc
cgtggagaatgccagcctgaagtatctgtgcggcatcgtggctgtggtagtgctgggcgtggccattgcccacggggttt
acaagtaa
>gnl|bcl2dbcds|K4FTK7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Callorhinchus milii GN=BOK (length=642 residues).
atggacatgttacggcgctcctcggtctttgctgctgaggtgatggaggtgtttgaacgttctccccctgacaaggagct
cgtttctcaggctaaagccctctgtcgggattacatccactcccggctgatccgagcaggcatagtctggagcaaacctg
agtgtgcagcagccagcccagccagcaaactcactgaggtgtcagctgcactcctccgcctgggtgatgaattagagtac
atcaggccgaacatgtacaggaatgtcgccaaacagttgaatatcaccgtcagttccgaaagcatcgtatcggatgcatt
tctcgctgtggccactgagatcttctctgcaggtataacttgggggaaggtggtagccttgtatgctgttgccggtggac
ttgccattgactgtgtgaaacaagggcaacctgccatggtgcacacaatagttgactgcctgggagaatttgtgcggaag
acactggtgacttggctccggagacggggaggatgggctgacattacaaaatccgtggtgaacaacgatcctagcattcg
tgatcactggctcgtctctgccgtctgcacgtttggacactttgtgaaagcggtcttcttctttctgctgcgagaacggt
ga
© 1998-2020Legal notice