Dataset for CDS BAK1 of Organism Calidris pygmaea

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3KH66_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Calidris pygmaea GN=BAK1 (length=900 residues).
atggtctggggttgggtttcgtttctttttttttttttttttcctctctctctctctctcttcttcttttccctcctcct
ccccggctccgctcgcttccttcccccgcgccgcgctccggggaggaggcaggaagggaggcggcggggatggagcagct
ccccgccgggatgcgttaactccccgggacacccctgctccccgccgggacgcggcaaagctgatattcccaagagtctc
tctgcaatggcctcagggaacaacggtgacccaccaagggcccacggacgccggggaagcaatggacgcaggccgtcgca
ggagctcaactcagaagaccaggtggtgaaggagacggaagaggtgtttaggagctatgccttctaccgctaccaacagg
agagagaggagagaggggaggaagtgcccatggacccagagatcgtggagatcgagcaggagctgggcagcactgggagc
caggtgggaaggcgcctggccatcatcggtgatgacattaacgagcggtacgacgcggagtttcgctacatgctgaaatc
cttgcagcccaccaaggagaacgcctatgagtacttcaccaaaatagcctccagcctgtttgagagtggcattaactggg
gccgggtgattgcgctgctgggctttggctaccacatggccatctacgtctaccagcacggcatcccgggtttcctccgc
cgcatcgctcgctacgtcgccgagttcatgctccggaaccgcatcgcccagtggatcgcccagcagggaggatgggtggc
tgcactcgatctggacaatgtttacatgaagtacatgctggtggtggtggccctggtcatggtggggcatttagtggtac
gacgcttcttcaggccctga
© 1998-2023Legal notice