Dataset for CDS BCL-2 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P10415_BCL2-04      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
A9QXG9_BCL2-01      atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-02      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
                    ******************** ***************************************

P10415_BCL2-04      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
A9QXG9_BCL2-01      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-02      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-01      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg

P10415_BCL2-04      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
A9QXG9_BCL2-01      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-02      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-01      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc

P10415_BCL2-04      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
A9QXG9_BCL2-01      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-02      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-01      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc

P10415_BCL2-04      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
A9QXG9_BCL2-01      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-02      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-01      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc

P10415_BCL2-04      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
A9QXG9_BCL2-01      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-02      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-01      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac

P10415_BCL2-04      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
A9QXG9_BCL2-01      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-02      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-01      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac

P10415_BCL2-04      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A9QXG9_BCL2-01      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-02      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-01      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag

P10415_BCL2-04      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
A9QXG9_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-02      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac

P10415_BCL2-04      ctgaaccggcacctgcacacctggatccaggataacggaggctggg--------------
A9QXG9_BCL2-01      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
P10415_BCL2-02      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
P10415_BCL2-01      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa

P10415_BCL2-04      -----------------------------taggtgcacttgg------------------
A9QXG9_BCL2-01      ctgtacggccccagcatgcggcctctgtttgatttctcctggctgtctctgaagactctg
P10415_BCL2-02      ctgtacggccccagcatgcggcctctgtttgatttctcctggctgtctctgaagactctg
P10415_BCL2-01      ctgtacggccccagcatgcggcctctgtttgatttctcctggctgtctctgaagactctg
                                                 *   * * * ***                  

P10415_BCL2-04      -------------tgatgtgag----------------------tctgggc------tga
A9QXG9_BCL2-01      ctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgagccacaagtga
P10415_BCL2-02      ctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
P10415_BCL2-01      ctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
                                 ** ** ***                      **** **      ***

© 1998-2020Legal notice