Dataset for CDS BCL-2 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P10415_BCL2-04      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-10      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-05      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-08      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-03      atga--------------------------------------------------------
A9QXG9_BCL2-01      atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-06      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-07      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccat
P10415_BCL2-09      atgg--------------------------------------------------------
                    ***                                                         

P10415_BCL2-04      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-10      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-05      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-08      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-06      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-07      tataagctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgccgcgcccccg
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-10      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-05      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-08      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-06      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-07      ggggccgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatccagcc
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-10      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-05      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-08      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-03      --atcccagggttc----------------------------------------------
A9QXG9_BCL2-01      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-06      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-07      gcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-10      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-05      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-08      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-06      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-07      gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-10      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-05      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-08      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-06      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-07      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-10      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-05      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-08      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-06      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-07      ctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttcagggac
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-10      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-05      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-08      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-06      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-07      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-10      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-05      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-08      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-03      ------------------------------------------------------------
A9QXG9_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-06      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-07      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
P10415_BCL2-09      ------------------------------------------------------------
                                                                                

P10415_BCL2-04      ctgaaccggcacctgcacacctggatccaggataacggaggctgg---------------
P10415_BCL2-10      ctgaaccggcacctgcacacctggatccaggataacggaggctgg---------------
P10415_BCL2-05      ctgaaccggcacctgcacacctggatccaggataacggaggctgg---------------
P10415_BCL2-08      ctgaaccggcacctgcacacctggatccaggataacggaggctggacagaaactcaggat
P10415_BCL2-03      -------------------------------------caggccaggatgcctttgtggaa
A9QXG9_BCL2-01      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
P10415_BCL2-06      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
P10415_BCL2-07      ctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
P10415_BCL2-09      -------------------------------------------aggatgcctttgtggaa
                                                                *               

P10415_BCL2-04      ------------------------------------------------------------
P10415_BCL2-10      ------------------------------------------------------------
P10415_BCL2-05      ------------------------------------------------------------
P10415_BCL2-08      ctgttcaacagtaatgcctgttcccccacgcctgcagccttggcaaccaccatactactg
P10415_BCL2-03      ctgtacggc------------------------------------cccagcatgcggcct
A9QXG9_BCL2-01      ctgtacggc------------------------------------cccagcatgcggcct
P10415_BCL2-06      ctgtacggc------------------------------------cccagcatgcggcct
P10415_BCL2-07      ctgtacggc------------------------------------cccagcatgcggcct
P10415_BCL2-09      ctgtacggc------------------------------------cccagcatgcggcct
                                                                                

P10415_BCL2-04      -------------------------------------gtaggtgcacttggtgatgtga-
P10415_BCL2-10      -------------------------------------gtaggtgcacttggtgatgtga-
P10415_BCL2-05      -------------------------------ctttacat---------------------
P10415_BCL2-08      cctgcctctatgaacttgactactctaggtacctcgcataagtggactcacacttgtgac
P10415_BCL2-03      ctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctg---------
A9QXG9_BCL2-01      ctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctg---------
P10415_BCL2-06      ctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctg---------
P10415_BCL2-07      ctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctg---------
P10415_BCL2-09      ctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctg---------
                                                                                

P10415_BCL2-04      ------------------------------------------gtctgggc----------
P10415_BCL2-10      ------------------------------------------gtctgggc----------
P10415_BCL2-05      ------------------------------------------------------------
P10415_BCL2-08      tggcttgttacactaagcatgatgtcttcaaggttcatccatgttttggcctgtgtcaca
P10415_BCL2-03      ------------------------------------------gtgggagcttgcatcacc
A9QXG9_BCL2-01      ------------------------------------------gtgggagcttgcatcacc
P10415_BCL2-06      ------------------------------------------gtgggagcttgcatcacc
P10415_BCL2-07      ------------------------------------------gtgggagcttgcatcacc
P10415_BCL2-09      ------------------------------------------gtgggagcttgcatcacc
                                                                                

P10415_BCL2-04      ------------------------tga
P10415_BCL2-10      ------------------------tga
P10415_BCL2-05      -----------------------gtga
P10415_BCL2-08      gcttccttcattttgaaggctgaatga
P10415_BCL2-03      ctgggtgcctatctgggccacaagtga
A9QXG9_BCL2-01      ctgggtgcctatctgagccacaagtga
P10415_BCL2-06      ctgggtgcctatctgggccacaagtga
P10415_BCL2-07      ctgggtgcctatctgggccacaagtga
P10415_BCL2-09      ctgggtgcctatctgggccacaagtga
                                            ***

© 1998-2021Legal notice