Dataset for CDS MCL-1 of organism Taeniopygia guttata

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A674HQK4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata GN=MCL-1 (length=507 residues).
atcgctaagaagctttttccgggtcttctcggtgggcccgggcggcccggggcggcgggggatgcggtgatggagaaggc
gctggagacgctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttcaaggaatgctgcggaagctgc
ggatccagcgagaagaagacctgcaggcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactggggc
cgggtggtgacgctcatctccttcggagccttcgtggccaagcacctgaagagcatccagcaggagcagggcatcggctg
cctggctgccatcatcaccgaggcgctggtctcctccaagagggagtggctggagagccaggggggctgggggggcttcg
tggacttcttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccggcctgggg
gccagcctggcctacctgatccggtga
>gnl|bcl2dbcds|A0A674HQK4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata GN=MCL-1 (length=1068 residues).
atgggagtcaggggacgaagtgggtggtccgttttccgccgaaaaaacggaagcggaggtggaaaaaaaaaaaaaaaaca
aacccaaaaatcaaaaaaaagctctcgctgtcccgccctcgccccgcctctccggcgtcaccggttatataacgcggccg
cgccggtcccgcccgcaccccgccggccgctcgcaccgggcgccatgttcgccgtgaagccgaaagctttcatcggcttc
aacctctactgcggcggctccccggggctgagccccgcggggccggaaccgcggccggagcctcaccgggaccctcaccg
ggaccctcaccgggaccccgcggagcctcaccgggaacaccgcggggccaccggcggcagcgccgaccccccccgcgcgc
tgattggtcgaggcgcggcgccgcgctcgctgattggctgcggcgcgactctctggcgccccgaggaggaactggacgga
tgcgaccccgaacccgaacgcggctccgccgccgccgcttcgctgcccgggaccccccccgggaccccgcccggagctcc
ggatgggctccggcaggactcgctggagctcatcagccgctacctgcgggaggtggctggggaggagcagcccagcaagg
cgctggagacgctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttcaaggaatgctgcggaagctg
cggatccagcgagaagaagacctgcaggcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactgggg
ccgggtggtgacgctcatctccttcggagccttcgtggccaagcacctgaagagcatccagcaggagcagggcatcggct
gcctggctgccatcatcaccgaggcgctggtctcctccaagagggagtggctggagagccaggggggctgggggggcttc
gtggacttcttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccggcctggg
ggccagcctggcctacctgatccggtga
© 1998-2023Legal notice