Dataset for CDS MCL-1 of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      atgggagtcaggggacgaagtgggtggtccgttttccgccgaaaaaacgg
                                                                          

A0A674HQK4_MCL1-01      ---------------------------------------atcgctaagaa
A0A674HQK4_MCL1-02      aagcggaggtggaaaaaaaaaaaaaaaacaaacccaaaaatcaaaaaaaa
                                                               ***   ** **

A0A674HQK4_MCL1-01      gct------------------------ttttccgg---------------
A0A674HQK4_MCL1-02      gctctcgctgtcccgccctcgccccgcctctccggcgtcaccggttatat
                        ***                         * *****               

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      aacgcggccgcgccggtcccgcccgcaccccgccggccgctcgcaccggg
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      cgccatgttcgccgtgaagccgaaagctttcatcggcttcaacctctact
                                                                          

A0A674HQK4_MCL1-01      -----gtcttctcgg---tgggcccgggcggcccggggcggcgg------
A0A674HQK4_MCL1-02      gcggcggctccccggggctgagccccgcggggccggaaccgcggccggag
                             * ** * ***   ** **** *  ** ****  * ****      

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      cctcaccgggaccctcaccgggaccctcaccgggaccccgcggagcctca
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ccgggaacaccgcggggccaccggcggcagcgccgaccccccccgcgcgc
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      tgattggtcgaggcgcggcgccgcgctcgctgattggctgcggcgcgact
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ctctggcgccccgaggaggaactggacggatgcgaccccgaacccgaacg
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      cggctccgccgccgccgcttcgctgcccgggaccccccccgggaccccgc
                                                                          

A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ccggagctccggatgggctccggcaggactcgctggagctcatcagccgc
                                                                          

A0A674HQK4_MCL1-01      -------gggatgcggtgatggag------------aaggcgctggagac
A0A674HQK4_MCL1-02      tacctgcgggaggtggctggggaggagcagcccagcaaggcgctggagac
                               **** * **    ****            **************

A0A674HQK4_MCL1-01      gctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttc
A0A674HQK4_MCL1-02      gctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttc
                        **************************************************

A0A674HQK4_MCL1-01      aaggaatgctgcggaagctgcggatccagcgagaagaagacctgcaggcg
A0A674HQK4_MCL1-02      aaggaatgctgcggaagctgcggatccagcgagaagaagacctgcaggcg
                        **************************************************

A0A674HQK4_MCL1-01      gtggtggaggtggctgcccacctcttcagcgacggggtgaccaactgggg
A0A674HQK4_MCL1-02      gtggtggaggtggctgcccacctcttcagcgacggggtgaccaactgggg
                        **************************************************

A0A674HQK4_MCL1-01      ccgggtggtgacgctcatctccttcggagccttcgtggccaagcacctga
A0A674HQK4_MCL1-02      ccgggtggtgacgctcatctccttcggagccttcgtggccaagcacctga
                        **************************************************

A0A674HQK4_MCL1-01      agagcatccagcaggagcagggcatcggctgcctggctgccatcatcacc
A0A674HQK4_MCL1-02      agagcatccagcaggagcagggcatcggctgcctggctgccatcatcacc
                        **************************************************

A0A674HQK4_MCL1-01      gaggcgctggtctcctccaagagggagtggctggagagccaggggggctg
A0A674HQK4_MCL1-02      gaggcgctggtctcctccaagagggagtggctggagagccaggggggctg
                        **************************************************

A0A674HQK4_MCL1-01      ggggggcttcgtggacttcttccgcctggaggacctggagggcagcgtcc
A0A674HQK4_MCL1-02      ggggggcttcgtggacttcttccgcctggaggacctggagggcagcgtcc
                        **************************************************

A0A674HQK4_MCL1-01      ggaacgttctgatggccttcgcgggggtggccggcctgggggccagcctg
A0A674HQK4_MCL1-02      ggaacgttctgatggccttcgcgggggtggccggcctgggggccagcctg
                        **************************************************

A0A674HQK4_MCL1-01      gcctacctgatccggtga
A0A674HQK4_MCL1-02      gcctacctgatccggtga
                        ******************

© 1998-2023Legal notice