Dataset for CDS MCL-1 of organism Amazona collaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9GMI8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amazona collaria GN=MCL-1 (length=801 residues).
atgttcgcgctcaagcggaaagcggtcatcggcctcaacctctactgcgggggcagcccggccccgccgccgccctcccc
ggcggcctgggccgcggggtgctccgaggcgctgctgggctgcggcccggtcccgctgcggagccccgaggaggagctgg
acggctgcgagccggagcccgagcgcggccccgcggcggccccgctgcccggcggcgcccccgacgccctgcgccaggcc
tcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggcccagcccgcgcccaagaagctgttcccggggct
gctgtgcgggcccgggcggccccgaggggcggcggattcggggctggagaaggcgctggagacgctgcggaggctcgggg
acagcgtcctgcggaagcacgagctcgcgttccagggaatgctccggaagctggaaatccagaaggaggaggacctgcag
gcggtgcacgaggtggctgcgcgcttgttcagcgacggggtgaccaactggggccgggtggtgacgctcatctccttcgg
ggccttcgtcgccaagcacctgaagagcatccggcaggagcagtgcatcggctccctggcagggatcatcacggacgcgc
tcctctcctccagtcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcacgtggaagacctg
gaaggcagcatcaggaatgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcgtacatgatccggtg
a
© 1998-2022Legal notice