Dataset for CDS BCL-2-like of organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1X9JZA1_BCL2-01      atg---gcgaacgagtgtaatcg-------caacattgtggaaaagtata
A0A8C4HJC9_BCL2L10      atgtgcagagagcagtctga----------tatcgctgggaggaaaatgg
A0A8C4IRU9_BCL2L1-      atg-----------------tcg-------tacagt------aacagaga
E6ZFR0_BCL2L1-01        atg-----------------tcg-------tacagt------aacagaga
A0A8P4G790_MCL1-01      atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaa
A0A8P4G790_MCL1-02      atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaa
                        ***                            *           *      

A0A1X9JZA1_BCL2-01      tctgccataaactctc--------------------caaaca---gggct
A0A8C4HJC9_BCL2L10      catgcgggc---------------------tgtggaaagagaccctggct
A0A8C4IRU9_BCL2L1-      gctg-gtggagttctt--------------------------tataagct
E6ZFR0_BCL2L1-01        gctg-gtggagttctt--------------------------tataagct
A0A8P4G790_MCL1-01      catgagcgtatttctcactcaaaatggaggcgtcgacggacacatgcact
A0A8P4G790_MCL1-02      catgagcgtatttctcactcaaaatggaggcgtcgacggacacatgcact
                          **                                            **

A0A1X9JZA1_BCL2-01      acgag------tgggggtttgacgctgtccggaatgcagatgccggtaat
A0A8C4HJC9_BCL2L10      ctgg-------cagaggactacctgtccctgtgctgcacaagcccccagc
A0A8C4IRU9_BCL2L1-      ataaactgtctcagaggaaccaccc-------------------------
E6ZFR0_BCL2L1-01        ataaactgtctcagaggaaccaccc-------------------------
A0A8P4G790_MCL1-01      acggac-----caggagattcatcccctcagatcgcaatgggctcttctc
A0A8P4G790_MCL1-02      acggac-----caggagattcatcccctcagatcgcaatgggctcttctc
                                     *  *                                 

A0A1X9JZA1_BCL2-01      aatgggtcaatagttgcccctc-----caccgagtttggtccgccggtgc
A0A8C4HJC9_BCL2L10      ca-------------gcccctc----------------------------
A0A8C4IRU9_BCL2L1-      -a-------------acctctc---------------------------t
E6ZFR0_BCL2L1-01        -a-------------acctctc---------------------------t
A0A8P4G790_MCL1-01      ta-------------gcctctcacaacgggagtgtcggctccagcgacgc
A0A8P4G790_MCL1-02      ta-------------gcctctcacaacgggagtgtcggctccagcgacgc
                         *              ** ***                            

A0A1X9JZA1_BCL2-01      cgtggagccagcaccgggcccgacagcgag------------------ag
A0A8C4HJC9_BCL2L10      ----------------aacctcccagcgag--------------------
A0A8C4IRU9_BCL2L1-      actga---ggccggagaatgccggtgaaag---gactgagggaga-----
E6ZFR0_BCL2L1-01        actga---ggccggagaatgccggtgaaag---gactgagggaga-----
A0A8P4G790_MCL1-01      cccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaa
A0A8P4G790_MCL1-02      cccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaa
                                                 *  **                    

A0A1X9JZA1_BCL2-01      catcccccacctctgcacacggctcccccagtccgacccgcatgccgcca
A0A8C4HJC9_BCL2L10      ------------------tcagc-------------------cgctgcca
A0A8C4IRU9_BCL2L1-      -------------caaggccaactcagctgccagaaacggcttgct----
E6ZFR0_BCL2L1-01        -------------caaggccaactcagctgccagaaacggcttgct----
A0A8P4G790_MCL1-01      caaaagccattcgcggggtcagcgacgacgtcgaggacggctctctgccg
A0A8P4G790_MCL1-02      caaaagccattcgcggggtcagcgacgacgtcgaggacggctctctgccg
                                           *  *                     *     

A0A1X9JZA1_BCL2-01      tccac--------------------------------------agagtcc
A0A8C4HJC9_BCL2L10      tg------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------ggcca-------------------------
E6ZFR0_BCL2L1-01        --------------------ggccagcaagaaca-------caagtggcc
A0A8P4G790_MCL1-01      tgcaccccggagctcctctcggacactgaaatcgacgtctccgggtgtcc
A0A8P4G790_MCL1-02      tgcaccccggagctcctctcggacactgaaatcgacgtctccgggtgtcc
                                                                          

A0A1X9JZA1_BCL2-01      tacgcgaggc------------tggagacgaa------------------
A0A8C4HJC9_BCL2L10      ----------------------aggcgc-----------atggcccagga
A0A8C4IRU9_BCL2L1-      ------------------------gcgctga-------------------
E6ZFR0_BCL2L1-01        agccggggacgtcttcgtcctcaggcgctga-------------------
A0A8P4G790_MCL1-01      agcgggggacg-----------aagtgttgaacagtgaaacgacgcaact
A0A8P4G790_MCL1-02      agcgggggacg-----------aagtgttgaacagtgaaacgacgcaact
                                                * *                       

A0A1X9JZA1_BCL2-01      ------------cttgaaagactgtaccagccggactt------------
A0A8C4HJC9_BCL2L10      cat-------------ggagac-------------------------gca
A0A8C4IRU9_BCL2L1-      cat-------------agaggctgtaaaggcagctcttcgggactcggca
E6ZFR0_BCL2L1-01        cat-------------agaggctgtaaaggcagctcttcgggactcggca
A0A8P4G790_MCL1-01      cattgactgtttcctgagagactttactgg--actttctaaatctcggtg
A0A8P4G790_MCL1-02      cattgactgtttcctgagagactttactgg--actttctaaatctcggtg
                                          ** *                            

A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A8C4HJC9_BCL2L10      gcac----------------------------------------------
A0A8C4IRU9_BCL2L1-      g-----------------------------atgagtt-tgaactgctctt
E6ZFR0_BCL2L1-01        g-----------------------------atgagtt-tgaactgctctt
A0A8P4G790_MCL1-01      gaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttt
A0A8P4G790_MCL1-02      gaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttt
                                                                          

A0A1X9JZA1_BCL2-01      ----------cacggagatgtcgcggcagctgtatc----tcacctccac
A0A8C4HJC9_BCL2L10      ----------caggctcgcttt-cagtccctggctc----agaccttcct
A0A8C4IRU9_BCL2L1-      ----------cacgcaagcgtt-tagtgacctttcctcgcagattgacat
E6ZFR0_BCL2L1-01        ----------cacgcaagcgtt-tagtgacctttcctcgcagattgacat
A0A8P4G790_MCL1-01      tggagaaacacagatacgcgta-caatggtatgatc-agaaaactgtcat
A0A8P4G790_MCL1-02      tggagaaacacagatacgcgta-caatggtatgatc-agaaaactgtcat
                                  **        *              *      *    *  

A0A1X9JZA1_BCL2-01      ca-------cggcgcagagg--------agattcgccgacgtgatagacg
A0A8C4HJC9_BCL2L10      gaggcagtgcgggccggacccctgctccagcctcaggagggtgatggagg
A0A8C4IRU9_BCL2L1-      cactcc---tgacacggcctaccac---agctttaaaagcgtgatggacg
E6ZFR0_BCL2L1-01        cactcc---tgacacggcctaccac---agctttaaaagcgtgatggacg
A0A8P4G790_MCL1-01      ta--ga---tgaaagggaggacgatgcaagctttgtcggggcggtagcaa
A0A8P4G790_MCL1-02      ta--ga---tgaaagggaggacgatgcaagctttgtcggggcggtagcaa
                         *        *     *           **  *       * * * *   

A0A1X9JZA1_BCL2-01      aac---tgttccgggacggg---gtgaactggggccggattatcgctttc
A0A8C4HJC9_BCL2L10      agc---tggtgggagacggacacttgaactgggggagggttgtttccatt
A0A8C4IRU9_BCL2L1-      agg---tgttcaaggatgga---gtgaactggggacgtatagtgggcctg
E6ZFR0_BCL2L1-01        agg---tgttcaaggatgga---gtgaactggggacgtatagtgggcctg
A0A8P4G790_MCL1-01      agagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctg
A0A8P4G790_MCL1-02      agagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctg
                        *     *  *    ** **       ********  *  *        * 

A0A1X9JZA1_BCL2-01      ttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagat
A0A8C4HJC9_BCL2L10      ttcacctttactggggtgctggccagactgctgctggagcagaaggacac
A0A8C4IRU9_BCL2L1-      tttgcctttggcggtgtactgtgtgtagaat--gtgtc-gagaaagatat
E6ZFR0_BCL2L1-01        tttgcctttggcggtgtactgtgtgtagaat--gtgtc-gagaaagatat
A0A8P4G790_MCL1-01      gttgcctttggagcggtggtgtct-cagtac--ctgacggagaagggcag
A0A8P4G790_MCL1-02      gttgcctttggagcggtggtgtct-cagtac--ctgacggagaagggcag
                         *    **    *      **             **    ** * *  * 

A0A1X9JZA1_BCL2-01      ggca------gcgcaggtg-------aacaacatcgcggagtggatga--
A0A8C4HJC9_BCL2L10      aaag------ccggggctggaccctggaagatgcagtggactggcggaga
A0A8C4IRU9_BCL2L1-      gagt---------gagctg----------------gt-------------
E6ZFR0_BCL2L1-01        gagt---------gagctg----------------gt-------------
A0A8P4G790_MCL1-01      gggcaactgtgtggagctg----------------gtgggacaggagatc
A0A8P4G790_MCL1-02      gggcaactgtgtggagctg----------------gtgggacaggagatc
                                       * **                *              

A0A1X9JZA1_BCL2-01      ------ctgagtatttaaatggacctctgaacagctggatacaagataac
A0A8C4HJC9_BCL2L10      ccatcgctgattacctgggagaggagaagagagagtggctgctggagaat
A0A8C4IRU9_BCL2L1-      ttcccg-----cat-------cgca-------gactggatgaccatgtac
E6ZFR0_BCL2L1-01        ttcccg-----cat-------cgca-------gactggatgaccatgtac
A0A8P4G790_MCL1-01      tcctcg-----tacctgctgacgcaccagcgggactggctggtcaagaac
A0A8P4G790_MCL1-02      tcctcg-----tacctgctgacgcaccagcgggactggctggtcaagaac
                                    *                      *** *        * 

A0A1X9JZA1_BCL2-01      gggggatgggatgcctttgtggagctgtatgacagacagagggactccgt
A0A8C4HJC9_BCL2L10      gacggatgggaggggttctgtaagttctgccgcagtgccagaga------
A0A8C4IRU9_BCL2L1-      ------ctggatgagcacatc-agtcc-----------------------
E6ZFR0_BCL2L1-01        ------ctggatgagcacatc-agtcc-----------------------
A0A8P4G790_MCL1-01      aactcttgggatggctttgtcgagttctttc---------gagt------
A0A8P4G790_MCL1-02      aactcttgggatggctttgtcgagttctttc---------gagt------
                                *** *         **                          

A0A1X9JZA1_BCL2-01      cttcagttgctcctg-gccctccattaagacgg---tcttcggtgtggct
A0A8C4HJC9_BCL2L10      ----agtgagtcaggactcgtccatgaagacagcgctgtttgccgctgct
A0A8C4IRU9_BCL2L1-      -----gtggatccagagc---caaggaggatgggact-----gctttgct
E6ZFR0_BCL2L1-01        -----gtggatccagagc---caaggaggatgggact-----gctttgct
A0A8P4G790_MCL1-01      ----agcagacccggagtccacagtgaggaacacactcatggcctttgct
A0A8P4G790_MCL1-02      ----agcagacccggagtccacagtgaggaacacactcatggcctttgct
                             *     *  *      *    * **      *          ***

A0A1X9JZA1_BCL2-01      gc-----------gcttggagcagctagcctc------------------
A0A8C4HJC9_BCL2L10      gg-----------cgtgggcctcgctggactc------------------
A0A8C4IRU9_BCL2L1-      ga-------ggtttttgggcgagac-------------------------
E6ZFR0_BCL2L1-01        ga-------ggtttttgggcgagac-------------------------
A0A8P4G790_MCL1-01      ggatttgccggtatcggggcgacactggccctgttgatcaga--------
A0A8P4G790_MCL1-02      ggatttgccggtatcggggcgacactggccctgttgatcagatcctcccc
                        *                **     *                         

A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A8C4HJC9_BCL2L10      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      ----------gccgccgcagaagcgag-------gagatctcgggag---
E6ZFR0_BCL2L1-01        ----------gccgccgcagaagcgag-------gagatctcgggag---
A0A8P4G790_MCL1-01      --cggcctaggctgctgt----------ttcctcgaaatttgatgag--a
A0A8P4G790_MCL1-02      gttgtctcgggttacaggacaaacaacactcatcgaggtcttaggaggaa
                                                                          

A0A1X9JZA1_BCL2-01      --------------------------------------accatc------
A0A8C4HJC9_BCL2L10      --------------------------------------accttcct----
A0A8C4IRU9_BCL2L1-      -----------------------------------------actctgagt
E6ZFR0_BCL2L1-01        -----------------------------------------actctgagt
A0A8P4G790_MCL1-01      ctgcagcagcgcctcc----------------------atcacactaagc
A0A8P4G790_MCL1-02      atggagtagagcctctccatggtgatgatccacagcagacctccctgtgt
                                                                          

A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A8C4HJC9_BCL2L10      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      agatggctg-----------------------------------------
E6ZFR0_BCL2L1-01        agatggctg-----------------------------------------
A0A8P4G790_MCL1-01      gctcagctg-----------------catccgccgagt------tgcaca
A0A8P4G790_MCL1-02      cctctcctgtggctaatgatgttagccaccaccctggttacccctgcaca
                                                                          

A0A1X9JZA1_BCL2-01      ---------------------ggagc------------------------
A0A8C4HJC9_BCL2L10      ------------------cctggtgc------------------------
A0A8C4IRU9_BCL2L1-      -ctaattg---------gggtggcgc------------------------
E6ZFR0_BCL2L1-01        -ctaattg---------gggtggcgc------------------------
A0A8P4G790_MCL1-01      gttctttgcaaa------gctggtgcataaca------------------
A0A8P4G790_MCL1-02      gttcattgtgaagaacaggctgctacacaatggggaattgaggctgaggc
                                             *   *                        

A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A8C4HJC9_BCL2L10      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      -----------------tgc---------------taatggga-------
E6ZFR0_BCL2L1-01        -----------------tgc---------------taatggga-------
A0A8P4G790_MCL1-01      -----tctgaa------tgcacca-gcacaagctatattgtgaaactggg
A0A8P4G790_MCL1-02      aattttctagagcggtttgcaccatacacaag-tgtattggg--------
                                                                          

A0A1X9JZA1_BCL2-01      -------------------------------------------gtacctt
A0A8C4HJC9_BCL2L10      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      ---------------------------gctgtggtcggggttctcat--t
E6ZFR0_BCL2L1-01        ---------------------------gctgtggtcggggttctcat--t
A0A8P4G790_MCL1-01      gttaaagagttcaaaattgtgtaccactctatttcctgggttggaaggct
A0A8P4G790_MCL1-02      -----agtgcagaaaacagactgcactgcagtgtcttggggctgaata-t
                                                                          

A0A1X9JZA1_BCL2-01      acacagaagtga-----------------------
A0A8C4HJC9_BCL2L10      gctag------------------------------
A0A8C4IRU9_BCL2L1-      gctaagaaacattga--------------------
E6ZFR0_BCL2L1-01        gctaagaaacattga--------------------
A0A8P4G790_MCL1-01      acctagaaactggggactttaaacaaatacattga
A0A8P4G790_MCL1-02      gcaaagcacccttggtctttga-------------
                         *                                 

© 1998-2023Legal notice