Dataset for CDS BCL2L1 of organism Salarias fasciatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672JL90_BCL2L1-      atgtcgtccagcaaccgagagctggtggagttctttttaagccacaggct
A0A672IDC1_BCL2L1-      at---gtctgagaaccgggagctggtcgttttctacatcacctacaaact
A0A672IDC1_BCL2L1-      at---gtctgagaaccgggagctggtcgttttctacatcacctacaaact
                        **   ***    ***** ******** *  ****   * * * ***  **

A0A672JL90_BCL2L1-      gtctcagaggaaccatcc-----------------------gtcctccct
A0A672IDC1_BCL2L1-      gtcccagaggaactaccctctcaaccacatagtgctcaatgagcctccca
A0A672IDC1_BCL2L1-      gtcccagaggaactaccctctcaaccacatagtgctcaatgagcctccca
                        *** ********* * **                         ****** 

A0A672JL90_BCL2L1-      gctgagaccgcaggatgcacggcaaaggaccgaggaagaccaggccagct
A0A672IDC1_BCL2L1-      gcaggactgacgggggggacggcggggacgccggggacgccgggtcgggc
A0A672IDC1_BCL2L1-      gcaggactgacgggggggacggcggggacgccggggacgccgggtcgggc
                        ** *      * **  * *****   *   *  ** *  ** ** * *  

A0A672JL90_BCL2L1-      catcggccag-----------------caatggctcggtgttcagcggca
A0A672IDC1_BCL2L1-      c-ccgaccagcggacggagacgcacgccaacgggacttttaccagcagga
A0A672IDC1_BCL2L1-      c-ccgaccagcggacggagacgcacgccaacgggacttttaccagcagga
                        *  ** ****                 *** **  *  *   **** * *

A0A672JL90_BCL2L1-      gtgctgggcg---gtcccagtctccacgcgccgaaactgacc--------
A0A672IDC1_BCL2L1-      gcagcgggagcccgccgccgtccccgc-tgcggcagctgggcgctggcgg
A0A672IDC1_BCL2L1-      gcagcgggagcccgccgccgtccccgc-tgcggcagctgggc--------
                        *    *** *   * * * *** ** *  ** * * ***  *        

A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      cgggggcggggctggcggcgggggcggggctggcggcgggggcggggccg
A0A672IDC1_BCL2L1-      --------------------------------------------------

A0A672JL90_BCL2L1-      ---------ctgtgaagtctgcccttctggactccgccgacgagttcgaa
A0A672IDC1_BCL2L1-      gcctggacgcggtgaaggaggccctgcgggacacggccaacgagttcgag
A0A672IDC1_BCL2L1-      -----------------gaggccctgcgggacacggccaacgagttcgag
                                            ***** * **** * *** ********** 

A0A672JL90_BCL2L1-      cttctcttcaagcaagctttcagcgatctttcctcgcagctcgacatcac
A0A672IDC1_BCL2L1-      ctgcgctactccatggccttcagcgacctgcacagccagctgcacatcac
A0A672IDC1_BCL2L1-      ctgcgctactccatggccttcagcgacctgcacagccagctgcacatcac
                        ** * ** *      ** ******** **   *   *****  *******

A0A672JL90_BCL2L1-      tcccgacacggcctaccacagcttcaagagcgtgatggacgaggtcttca
A0A672IDC1_BCL2L1-      gcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttcc
A0A672IDC1_BCL2L1-      gcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttcc
                         **** *** ******** ****** *** *************** *** 

A0A672JL90_BCL2L1-      aggatggcgtcaactgggggcgtatcgtaggcctgtttgccttcggcggc
A0A672IDC1_BCL2L1-      gggacggcgtcaactgggggcgcatcgtgggcctgttcgccttcggcggc
A0A672IDC1_BCL2L1-      gggacggcgtcaactgggggcgcatcgtgggcctgttcgccttcggcggc
                         *** ***************** ***** ******** ************

A0A672JL90_BCL2L1-      gtgctgtgcgtggagtgtgtggagaaggacatgagcgagctggtgtcacg
A0A672IDC1_BCL2L1-      gcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggag
A0A672IDC1_BCL2L1-      gcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggag
                        * *************** *********** ******   ******    *

A0A672JL90_BCL2L1-      cattgcagactggatgaccatgtacctggatgagaacatcaatttctgga
A0A672IDC1_BCL2L1-      gatcgtggagtggatgacggtctacctggacaaccacatccagccctgga
A0A672IDC1_BCL2L1-      gatcgtggagtggatgacggtctacctggacaaccacatccagccctgga
                         ** *  ** ********  * ********  *  ***** *   *****

A0A672JL90_BCL2L1-      ttgagagccaggggggatgggaatacttcgctgagattttcgggcgtggc
A0A672IDC1_BCL2L1-      tccagagccaagggggatgggagcgctttgccgagatcttcgggcaggac
A0A672IDC1_BCL2L1-      tccagagccaagggggatgggagcgctttgccgagatcttcgggcaggac
                        *  ******* ***********   *** ** ***** *******  * *

A0A672JL90_BCL2L1-      gctgcttcagaggcgaggagatcccgggagaagatgacgaggtggctgct
A0A672IDC1_BCL2L1-      gcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgct
A0A672IDC1_BCL2L1-      gcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgct
                        ** **  * ****   ** * ***  *****   * * ** *********

A0A672JL90_BCL2L1-      agttggggtggcgctgctagcgggagtgctgatcggcgtgggcatcgcta
A0A672IDC1_BCL2L1-      ggtggggatgacggtggtgacgggcttcgtggtgggctcgctgttcgccc
A0A672IDC1_BCL2L1-      ggtggggatgacggtggtgacgggcttcgtggtgggctcgctgttcgccc
                         ** *** ** ** ** *  ****  *  ** * ***  *    ****  

A0A672JL90_BCL2L1-      agagaca---gtga
A0A672IDC1_BCL2L1-      agaagcgcctgtga
A0A672IDC1_BCL2L1-      agaagcgcctgtga
                        ***  *    ****

© 1998-2021Legal notice