Dataset for CDS BCL2L1 of organism Salarias fasciatus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A672IDC1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=759 residues).
atgtctgagaaccgggagctggtcgttttctacatcacctacaaactgtcccagaggaactaccctctcaaccacatagt
gctcaatgagcctcccagcaggactgacgggggggacggcggggacgccggggacgccgggtcgggccccgaccagcgga
cggagacgcacgccaacgggacttttaccagcaggagcagcgggagcccgccgccgtccccgctgcggcagctgggcgct
ggcggcgggggcggggctggcggcgggggcggggctggcggcgggggcggggccggcctggacgcggtgaaggaggccct
gcgggacacggccaacgagttcgagctgcgctactccatggccttcagcgacctgcacagccagctgcacatcacgcccg
ccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgggggcgcatcgtgggcctg
ttcgccttcggcggcgcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggaggatcgtggagtggat
gacggtctacctggacaaccacatccagccctggatccagagccaagggggatgggagcgctttgccgagatcttcgggc
aggacgcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgctggtggggatgacggtggtgacgggc
ttcgtggtgggctcgctgttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A672IDC1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=684 residues).
atgtctgagaaccgggagctggtcgttttctacatcacctacaaactgtcccagaggaactaccctctcaaccacatagt
gctcaatgagcctcccagcaggactgacgggggggacggcggggacgccggggacgccgggtcgggccccgaccagcgga
cggagacgcacgccaacgggacttttaccagcaggagcagcgggagcccgccgccgtccccgctgcggcagctgggcgag
gccctgcgggacacggccaacgagttcgagctgcgctactccatggccttcagcgacctgcacagccagctgcacatcac
gcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgggggcgcatcgtgg
gcctgttcgccttcggcggcgcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggaggatcgtggag
tggatgacggtctacctggacaaccacatccagccctggatccagagccaagggggatgggagcgctttgccgagatctt
cgggcaggacgcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgctggtggggatgacggtggtga
cgggcttcgtggtgggctcgctgttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A672JL90_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=651 residues).
atgtcgtccagcaaccgagagctggtggagttctttttaagccacaggctgtctcagaggaaccatccgtcctccctgct
gagaccgcaggatgcacggcaaaggaccgaggaagaccaggccagctcatcggccagcaatggctcggtgttcagcggca
gtgctgggcggtcccagtctccacgcgccgaaactgaccctgtgaagtctgcccttctggactccgccgacgagttcgaa
cttctcttcaagcaagctttcagcgatctttcctcgcagctcgacatcactcccgacacggcctaccacagcttcaagag
cgtgatggacgaggtcttcaaggatggcgtcaactgggggcgtatcgtaggcctgtttgccttcggcggcgtgctgtgcg
tggagtgtgtggagaaggacatgagcgagctggtgtcacgcattgcagactggatgaccatgtacctggatgagaacatc
aatttctggattgagagccaggggggatgggaatacttcgctgagattttcgggcgtggcgctgcttcagaggcgaggag
atcccgggagaagatgacgaggtggctgctagttggggtggcgctgctagcgggagtgctgatcggcgtgggcatcgcta
agagacagtga
© 1998-2020Legal notice