Dataset for CDS BCL-2-like of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5KD08_BCL2L10      atgtcg------------------------------------tgcgggct
H2U5I3_BCL2L1-01        atgtcgtataacaacagagagctggtggagcacttcttaagatacaagct
                        ******                                    * *  ***

A0A3B5KD08_BCL2L10      gt------------------------------------------------
H2U5I3_BCL2L1-01        gtctcagaggaactacccaacttctctgctgagaccagaggatactgatg
                        **                                                

A0A3B5KD08_BCL2L10      --------------ggaaagag--accctggctcttgcagaggactacct
H2U5I3_BCL2L1-01        gaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctg
                                      * ******   *** *   *** **  ** ** *  

A0A3B5KD08_BCL2L10      gtccctgtgcagcacaagccagtgtccagcccctccacctcc--------
H2U5I3_BCL2L1-01        gtcc----gcagcaggaacaggggtggagcgtctccatccgcaggtgctg
                        ****    ******  * *  * **  ***  ***** *  *        

A0A3B5KD08_BCL2L10      -cagcgagtc---ggccactgccatgaggcacctgggtcaggacatggag
H2U5I3_BCL2L1-01        gcatagaggctgtgaacgcagctcttcgggactcggcagaagagtttgag
                         **  *** *   *  * * **  *  ** **  **   * **  * ***

A0A3B5KD08_BCL2L10      aagc----------agcaccaggctcggttcaactccctagctcagacct
H2U5I3_BCL2L1-01        aagctctttgctcaagcattcag--cgacctctcctcacagctc-gacat
                        ****          ****    *  **      *  *  ***** *** *

A0A3B5KD08_BCL2L10      ---tcctgagacagtgcgggccggacctctgctccagcctcaggaaagtg
H2U5I3_BCL2L1-01        cactcctgacacag-------------cttaccagagctttaagaatgtg
                           ****** ****               * *   *** * * *** ***

A0A3B5KD08_BCL2L10      atggaggagctggtgggagatggacacttgaactggggaagggttgtatc
H2U5I3_BCL2L1-01        atggacgaggtgttcaaggacgga---gtcaactggggacgagttgtggg
                        ***** *** ** *    ** ***    * ********* * *****   

A0A3B5KD08_BCL2L10      ccttttcacctttactggggtgctggccagactgatgcaggagcagaaga
H2U5I3_BCL2L1-01        actatttgcctttggcggggtacta--------tgtgtggaatgtgtcga
                         ** **  *****   ***** **           **  * *   *  **

A0A3B5KD08_BCL2L10      gcacaaagccggggctggaccctggacaagagcagcaactgggacaggtg
H2U5I3_BCL2L1-01        gaa--------------------ggatgcgagc--caactgg----tttg
                        * *                    ***   ****  *******      **

A0A3B5KD08_BCL2L10      cccgaaaactgcaggggactcgcggagaccatagcagactatctaggaga
H2U5I3_BCL2L1-01        cc---gcattgcaga-----ctggatgaccat------ttacctggatga
                        **     * *****      *  *  ******       ** ** *  **

A0A3B5KD08_BCL2L10      ggagaagaaagactggctgctggagaatggcggatggga---------gg
H2U5I3_BCL2L1-01        gcatattaacccgtggatccagagtcaaggaggatgggattgcttcgcga
                        * * *  **    *** * * *    * ** ********         * 

A0A3B5KD08_BCL2L10      ggttctgtaagtactccctcgctgccagggaggtgaa---tcacga----
H2U5I3_BCL2L1-01        agatttttggggacgacgccgcggcagaggggaggagagctcgcgagaac
                         * * * *  * **  *  *** **   ** *  **    ** ***    

A0A3B5KD08_BCL2L10      -ctcgtccatgaagaccgcactgttcgccgctgccggggtcggtctcgcc
H2U5I3_BCL2L1-01        ctgagtagatggatgctgggcggattggcgctgctgatgggagttttggt
                            **  *** *  * *  * * * * ****** *  *   ** * *  

A0A3B5KD08_BCL2L10      gggctcacgttcctcct---ggtgcgctag
H2U5I3_BCL2L1-01        cgg--cgctttcatcgtcaagaaacattga
                         **  * * *** ** *   *   *  *  

© 1998-2020Legal notice