Dataset for CDS BCL-2-like of organism Carlito syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7UZD8_BCL2L10      atggccgacccgctggaggagcgtaccgcgcgg---ctgctggctgacta
A0A1U7T4L4_BCL2L1-      ---------------atgtctcagagcaaccgggagctggtggttgactt
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt

A0A1U7UZD8_BCL2L10      cct-----------------------------------------------
A0A1U7T4L4_BCL2L1-      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tgtaggctataag-------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tgtaggctataag-------------------------------------

A0A1U7UZD8_BCL2L10      -------ggagtactgcgcccggccgcccggcagccccgagccgcggccg
A0A1U7T4L4_BCL2L1-      atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatg
A0A1U7T4L4_BCL2L1-      atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatg
A0A1U7UJF2_BCL2L2-      ------------------ctgaggc----agaagggttatgtctgtggag
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ------------------ctgaggc----agaagggttatgtctgtggag

A0A1U7UZD8_BCL2L10      tcctcgcccgaggccgccgtgctgcgctccacggccgccaggctg-----
A0A1U7T4L4_BCL2L1-      gagacccccagtgccgt-----------caatggcaacccatcctggcac
A0A1U7T4L4_BCL2L1-      gagacccccagtgccgt-----------caatggcaacccatcct-----
A0A1U7UJF2_BCL2L2-      ccggccctggggagggc-----------cca--gcagccgacccg-----
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ccggccctggggagggc-----------cca--gcagccgacccg-----

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      ctggtggacagccccgcggtgaatggagccactggccacagcagcagttt
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      ggatgcccgggaggtgatccccatggcagctgtgaagcaagcgctgaggg
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      -------------------------------ctgcaccaagccatgcggg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      -------------------------------ctgcaccaagccatgcggg

A0A1U7UZD8_BCL2L10      -----------------------cggcagcggcacgcctccttcttctcg
A0A1U7T4L4_BCL2L1-      aggcaggcgatgagtttgaactgcggtaccggcgggcattcagtgacctg
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      cagctggagatgagttcgagacccgcttccggcgcacgttctctgatctg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      cagctggagatgagttcgagacccgcttccggcgcacgttctctgatctg

A0A1U7UZD8_BCL2L10      gccttc-----gttgactaccccgggagccgcgtggacctg--------a
A0A1U7T4L4_BCL2L1-      acgtcccagctccacatcaccccagggacagcgtatcagagttttgaaca
A0A1U7T4L4_BCL2L1-      ------------------------gggacagcgtatcagagttttgaaca
A0A1U7UJF2_BCL2L2-      gcggctcagctgcatgtgaccccaggctcagcccagcaacgcttcaccca
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gcggctcagctgcatgtgaccccaggctcagcccagcaacgcttcaccca

A0A1U7UZD8_BCL2L10      cggcgcggatggccgatgccgtgctctctggcagccgcgacctcagctgg
A0A1U7T4L4_BCL2L1-      ggtagtgaacgaactcttccggg-------------atggggtaaactgg
A0A1U7T4L4_BCL2L1-      ggtagtgaacgaactcttccggg-------------atggggtaaactgg
A0A1U7UJF2_BCL2L2-      ggtctctgatgaacttttccaag-------------ggggccccaactgg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ggtctctgatgaacttttccaag-------------ggggccccaactgg

A0A1U7UZD8_BCL2L10      ggccgcgtggtgacgctcgtgaccttcgcggggacgcttctggagcgagg
A0A1U7T4L4_BCL2L1-      ggtcgcatcgtggcctttttctccttcggcggggcact------------
A0A1U7T4L4_BCL2L1-      ggtcgcatcgtggcctttttctccttcggcggggcact------------
A0A1U7UJF2_BCL2L2-      ggccgccttgtggccttctttgtctttggggctgcact------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ggccgccttgtggccttctttgtctttggggctgcact------------

A0A1U7UZD8_BCL2L10      accgctgctgcccgccggggggcagcagcggggcttcaggccccggcgga
A0A1U7T4L4_BCL2L1-      -------gtgtgtggagagcgtagacaa-ggagatgcaggtattggtgag
A0A1U7T4L4_BCL2L1-      -------gtgtgtggagagcgtagacaa-ggagatgcaggtattggtgag
A0A1U7UJF2_BCL2L2-      -------ctgtgctgaaagtgtcaacaa-ggagatggagccactggtggg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      -------ctgtgctgaaagtgtcaacaa-ggagatggagccactggtggg

A0A1U7UZD8_BCL2L10      agaaggaggagggcgacgttgcgcgggactgccagcgcctggtggccttg
A0A1U7T4L4_BCL2L1-      tcggatcgcaacttgg----------------------atggccacttac
A0A1U7T4L4_BCL2L1-      tcggatcgcaacttgg----------------------atggccacttac
A0A1U7UJF2_BCL2L2-      acaagtgcaggagtgg----------------------atggtggcctac
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      acaagtgcaggagtgg----------------------atggtggcctac

A0A1U7UZD8_BCL2L10      ctgagcgcgcggctcgcggggcggcacc---------gcgcctgg-----
A0A1U7T4L4_BCL2L1-      ctgaatgaccacctagagccttggatccaggacaacggcggctgg-----
A0A1U7T4L4_BCL2L1-      ctgaatgaccacctagagccttggatccaggacaacggcggctgg-----
A0A1U7UJF2_BCL2L2-      ctggagacgcggctggccgactggatccacagcagtgggggctgg-----
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ctggagacgcggctggccgactggatccacagcagtgggggctgggagct

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      -------------------------------------------gacactt
A0A1U7T4L4_BCL2L1-      -------------------------------------------gacactt
A0A1U7UJF2_BCL2L2-      -------------------------------------------gcggagt
A0A1U7UJF2_BCL2L2-      ----------------------------atggaggaggaagctgaaaagc
A0A1U7UJF2_BCL2L2-      ggaagcgatcaaagcccgagtcagggagatggaggaggaagctgaaaagc

A0A1U7UZD8_BCL2L10      ----------ctgcaggctcaaggcg------------------------
A0A1U7T4L4_BCL2L1-      ttgtggaactctacgggaacaatgcagca---------------------
A0A1U7T4L4_BCL2L1-      ttgtggaactctacgggaacaatgcagca---------------------
A0A1U7UJF2_BCL2L2-      tcacagctctatacggggacggggc-------------------------
A0A1U7UJF2_BCL2L2-      taaaagagctaca---gaacgaggtagagaagcagatgaatatgagtcca
A0A1U7UJF2_BCL2L2-      taaaagagctaca---gaacgaggtagagaagcagatgaatatgagtcca
                                        *  *   *                          

A0A1U7UZD8_BCL2L10      ------------gctgggatggcttttgtgtcttcttcagtacaccctta
A0A1U7T4L4_BCL2L1-      ------------gctg-------------------------agagccgga
A0A1U7T4L4_BCL2L1-      ------------gctg-------------------------agagccgga
A0A1U7UJF2_BCL2L2-      cctggaggaggcgcgg------------cgtctgcgggaggggaactggg
A0A1U7UJF2_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggaaaagatgga
A0A1U7UJF2_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggaaaagatgga
                                    ** *                           *      

A0A1U7UZD8_BCL2L10      --------------------ccactaactttttggagaagactgccggtt
A0A1U7T4L4_BCL2L1-      ---------------------------------------------agggc
A0A1U7T4L4_BCL2L1-      ---------------------------------------------agggc
A0A1U7UJF2_BCL2L2-      ---------------catcagtgaggacagtgctga--------cgggag
A0A1U7UJF2_BCL2L2-      ggctgatgctcgttccatctatgttggcaatgtggactatggtgcaacag
A0A1U7UJF2_BCL2L2-      ggctgatgctcgttccatctatgttggcaatgtggactatggtgcaacag

A0A1U7UZD8_BCL2L10      cag--gcgtttgtgtcatgccttt--------------------------
A0A1U7T4L4_BCL2L1-      caggagcgcttcaaccgctggttcctgacgg-------------------
A0A1U7T4L4_BCL2L1-      caggagcgcttcaaccgctggttcctgacgg-------------------
A0A1U7UJF2_BCL2L2-      ccgtggcactgggggccc--------------------------------
A0A1U7UJF2_BCL2L2-      cagaagagctagaagctcactttcatggctgtggttcagtcaaccgtgtt
A0A1U7UJF2_BCL2L2-      cagaagagctagaagctcactttcatggctgtggttcagtcaaccgtgtt
                        * *  *   *     *                                  

A0A1U7UZD8_BCL2L10      --------------tagcaatggccttcatct----attttttct-----
A0A1U7T4L4_BCL2L1-      -----------gcatgaccgtagctggcgt------ggttctgct-----
A0A1U7T4L4_BCL2L1-      -----------gcatgaccgtagctggcgt------ggttctgct-----
A0A1U7UJF2_BCL2L2-      -----------tggtaactgtaggggcctt--------ttttgct-----
A0A1U7UJF2_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaaggttttgcttatat
A0A1U7UJF2_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaaggttttgcttatat
                                            * *    * *        ** * **     

A0A1U7UZD8_BCL2L10      -ggacacgattatta--------tga------------------------
A0A1U7T4L4_BCL2L1-      -gggctcgctcttcagtcggaaatga------------------------
A0A1U7T4L4_BCL2L1-      -gggctcgctcttcagtcggaaatga------------------------
A0A1U7UJF2_BCL2L2-      -----------------agcaagtga------------------------
A0A1U7UJF2_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccctggccttagatgagt
A0A1U7UJF2_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccctggccttagatgagt

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ccctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaacaga
A0A1U7UJF2_BCL2L2-      ccctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaacaga

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ccaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtgc
A0A1U7UJF2_BCL2L2-      ccaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtgc

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ccggaccaccaattacaacagttcccgctctcgattctacagtggtttta
A0A1U7UJF2_BCL2L2-      ccggaccaccaattacaacagttcccgctctcgattctacagtggtttta

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      acagcaggcctcggggtcgcgtctacaggggccgggctagagcgacatca
A0A1U7UJF2_BCL2L2-      acagcaggcctcggggtcgcgtctacaggggccgggctagagcgacatca

A0A1U7UZD8_BCL2L10      ------------------
A0A1U7T4L4_BCL2L1-      ------------------
A0A1U7T4L4_BCL2L1-      ------------------
A0A1U7UJF2_BCL2L2-      ------------------
A0A1U7UJF2_BCL2L2-      tggtattccccttactaa
A0A1U7UJF2_BCL2L2-      tggtattccccttactaa

© 1998-2022Legal notice